ABSTRACT
Title of dissertation: PHYLOGENETIC STUDIES OF THE CHARALES: THE
CLOSEST LIVING RELATIVES OF LAND PLANTS
Kenneth Gregory Karol, Doctor of Philosophy, 2004
Dissertation directed by: Associate Professor Charles F. Delwiche
Department of Plant Biology
The embryophytes (land plants) consist of organisms such as mosses, ferns,
conifers and flowering plants. Although land plants have long been thought to be related
to the green algal group Charophyceae, the nature of this relationship has been
unresolved for over a century. A four-gene phylogenetic analysis supports the hypothesis
that land plants arose from within the Charophyta and unambiguously identifies the
Charales as the closest living relatives of plants. With a robust phylogeny, it is now
possibly to explore phylogeny-dependant questions that were previously difficult to
assess. Estimating the divergence time of the land plant lineage is one such question. A
recent time estimate for the colonization of land by plants is 1,061 ? 109 mya and 703 ?
45 mya for the divergence of vascular plants and bryophytes, a result much older than the
fossil record suggests (roughly 470 mya). Unlike most algae, a rich fossil record exists
for the Charales in the form of calcified oospores. Representative fossils that can be
attributed to five extant lineages in the Charales have been identified with reasonable
accuracy. These multiple calibration points were used in conjunction with the four-gene
DNA data set to estimate the divergence time of the land plant and Charales lineages.
The Bayesian relaxed-clock approach estimated divergence of the Charales/land plant
common ancestor in the Late Proterozoic (674.10 ? 99.96 MYA), modern land plants in
the Cambrian (497.78 ? 75.66 MYA), and modern Characeae at the Paleozoic/Mesozoic
boundary (247.75 ? 25.98 MYA). The genus Nitella is one of the most diverse genera in
the Charales. Wood and Imahori?s worldwide monograph divides Nitella into three
subgenera with seventeen sections and radically modified the taxonomy of this group my
submerging over 200 Nitella species into 53 loosely defined species. Phylogenetic
analyses of rbcL sequence data from 79 Nitella species (plus outgroups) support the
monophyly of Nitella and two subgenera (Hyella and Tieffallenia). Subgenus Nitella
formed two paraphyletic lineages at the base of the genus. Few sections were
monophyletic and species diversity is interpreted as being much higher than proposed by
Wood.
PHYLOGENETIC STUDIES OF THE CHARALES: THE CLOSEST LIVING
RELATIVES OF LAND PLANTS
by
Kenneth Gregory Karol
Dissertation submitted to the Faculty of the Graduate School of the
University of Maryland, College Park in partial fulfillment
of the requirement for the degree of
Doctor of Philosophy
2004
Advisory Committee:
Associate Professor Charles F. Delwiche, Chair
Professor Todd J. Cooke
Dr. Richard M. McCourt
Professor Charles Mitter
Dr. Elizabeth A. Zimmer
?Copyright by
Kenneth G. Karol
2004
ii
To Gregory A. French
iii
Acknowledgements
As an undergraduate student at the University of Madison I distinctly remember
asking a group of graduate students ?What does a Ph.D mean??  After some discussion,
the group converged on the answer that a Ph.D. demonstrates a students? ability to
?perform independent research at a high academic level.?  Now that I have been through
this process I must disagree.  If it weren?t for the assistance and support of numerous
friends and colleagues this dissertation would have been impossible.
I am particularly indebted to my graduate committee.  Chuck Delwiche for
offering the opportunity to be his student and supplying the environment for brutally
honest scientific discussion and the freedom to think out loud.  Todd Cook for
recognizing the more unusual side of my personality and allowing it to grow, not to
mention stimulating conversations in the halls and on the loading dock.  Rick McCourt
for his never-ending friendship and for introducing me to the Characeae.  Liz Zimmer for
her encouragement, friendship and scientific integrity and Charlie Mitter for keeping me
on my toes.
Tsetso Bachvaroff, Matt Cimino, Chris Drummond, John Hall, Malin Hibbs, Jeff
Lewandowski, Tanya Marushak, Virginia Sanchez-Puerta, Steve Snyder and Adam
Zacardii, members of the Delwiche lab, deserve special thanks.
For sharing conversation and Characeae material I thank Mitch Alix, Rob
Bartleson, Mary Bisson, Becky Bixby, Jelena Blazencic, Jon Bollback, Robb Brumfield,
Michelle Casanova, John Clayton, Monique Feist, Adriana Garcia, David Hewitt, Henry
Mann, John Porter, James Reveal, Robin Scribailo, Ingaborg Soule-Marche, Mary de
Winton and the International Group on Charophytes (IRGC).  I would like to thank Vern
iv
Proctor for sharing his culture collection, field experience and hypotheses of
charophyte evolution.
I am indepted to my partner Greg French for his unconditional support and
encouragement.
v
TABLE OF CONTENTS
Chapter I:  General introduction.............................................1
Introduction...........................................................1
Overview of the Charophyta.............................................1
Overview of the Charales...............................................2
Aims.........................................................................7
Chapter II:  The closest living relatives of land plants............................8
Introduction...........................................................8
Materials and Methods..................................................12
DNA isolation, PCR, and sequencing.....................................12
Phylogenetic analyses.................................................17
Results..............................................................19
Taxa and data set.....................................................19
Discussion...........................................................33
Chapter III:  Estimating divergence times in the Charophyta......................37
Introduction..........................................................37
Overview..................................................................37
The fossil record.....................................................40
Materials and Methods..................................................42
Taxon sampling.........................................................42
DNA isolation, PCR, and sequencing.....................................44
Phylogenetic analyses.................................................46
Estimating divergence times............................................47
Results..............................................................51
Phylogenetic analyses.................................................51
Estimating divergence times............................................55
Discussion...........................................................69
Phylogenetic analyses.................................................69
'Simple? and ?complex? models.........................................71
The fossil record of Characeae genera....................................72
Single versus multiple calibration points..................................75
Proterozoic origin and diversification of the Charophyta......................76
Diversification of land plants...........................................78
Chapter IV:  Phylogeny of Nitella (Charales: Charophyta).......................81
Introduction..........................................................81
Overview.................................................................81
Materials and Methods..................................................87
DNA isolation, PCR, and sequencing.....................................87
Phylogenetic analyses.................................................90
Results and Discussion.................................................92
vi
Taxa and data set.....................................................92
The ?n = 6/12 (15)? clade.............................................100
The ?n = 9/18? clade.................................................108
Subgenus Hyella....................................................110
Subgenus Tieffallenia................................................114
Conclusions..............................................................121
Appendix I.  Clade names and definitions...................................123
Appendix II. Summary of species and source information for Characeae...........124
References............................................................125
vii
LIST OF TABLES
Chapter II
Table II-1.  Lists of species..............................................13
Table II-2.  PCR and sequencing primers...................................16
Table II-3.  Mean base composition values across taxa.........................20
Table II-4.  Pair-wise comparisons of nad5 intron sequences....................22
Chapter III
Table III-1   Lists of species.............................................45
Table III-2.  List of constrained lineages with geologic age.....................49
Table III-3.  Estimated-parameter values for divergence times estimation..........50
Table III-4.  Estimated divergence times within the Charophyta..................56
Chapter IV
Table IV-1.  Mean base composition values across taxa........................93
viii
LIST OF FIGURES
Chapter II
Figure II-1.  Representative green algal species in the Charophyta................9
Figure II-2.  Phylogenetic relationships for the Charophyta determined by Bayesian
inference.............................................................24
Figure II-3.  Phylogenetic relationships of the Charophyta using additional analytical
methods.............................................................26
Figure II-4.  Kishino-Hasegawa test results..................................31
Chapter III
Figure III-1.  Phylogenetic relationships for the Charophyta determined by Bayesian
inference.............................................................52
Figure III-2.  Divergence times inferred from Bayesian relaxed molecular clock
approach.............................................................64
Figure III-3.  Comparison of the posterior 95% credible intervals................67
Chapter IV
Figure IV-1.  Hypothetical evolutionary sequence of Nitella sensu Wood (1965)....84
Figure IV-2.  Phylogenetic relationships for the Charales determined by Bayesian
inference.............................................................96
Figure IV-3.  Phylogenetic relationships for basal lineages of Nitella.............98
Figure IV-4.  Phylogenetic relationships for Nitella subgenus Hyella............104
Figure IV-5.  Phylogenetic relationships for Nitella subgenus Tieffallenia........106
1
Chapter I:  General introduction
Introduction
Overview of the Charophyta
Green plants sensu lato are comprised of two distinct lineages termed Charophyta
and Chlorophyta.  The Charophyta represent an important lineage in the tree of life
because land plants (or embryophytes) are derived from within this group and therefore
have received considerable attention since the early history of systematic botany (Bower,
1908; Darwin, 1859; Fritsch, 1935; Smith, 1938).  The Charophyta comprise not only the
land plants but also several lineages of fresh-water green algae.  The latter exhibit a broad
range of morphological diversity including biflagellate unicells (Mesostigmatales),
sessile unicells (some Zygnematales), sarcinoid packets of cells (Chlorokybales),
unbranched filaments (Klebsormidiales and some Zygnematales), and relatively complex
branched filaments (Charales and Coleochaetales).  The Charophyta are sister to the
Chlorophyta, which comprises essentially all other green algae (Friedl, 1997; Mattox and
Stewart, 1984; Mishler et al., 1994; Pickett-Heaps, 1975; Pickett-Heaps and Marchant,
1972).
Several influential works emphasized ultrastructural features such as mode of cell
division and flagellar root structure to erect the green algal class Charophyceae (Mattox
and Stewart, 1984; Pickett-Heaps, 1975; Stewart and Mattox, 1975; Stewart and Mattox,
1978).  A suite of biochemical and additional ultrastructural characters have since been
identified that confirm a close relationship of these algae with land plants (Cook and
Graham, 1998; Cook et al., 1997; Cook et al., 1998; De Jesus et al., 1989; Delwiche et
2
al., 1989; Domozych et al., 1980; Frederick et al., 1973; Hotchkiss Jr. and Brown Jr.,
1987; Jacobshagen and Schnarrenberger, 1990; Okuda and Brown Jr., 1992; Syrett and
Al-Houty, 1984).  Molecular phylogenetic analyses have verified monophyly of most of
the charophyte orders and unequivocally established land plant ancestry within the
charophycean green algae (Chapman and Buchheim, 1991; Chapman et al., 1998;
Delwiche et al., 2002; Delwiche et al., 1995; Gontcharov et al., 2003; Manhart, 1994;
Marin and Melkonian, 1999; McCourt, 1995; McCourt et al., 2000; McCourt et al.,
1996a).  However, branching patterns among these lineages have been only weakly
supported, as measured by bootstrap values (McCourt, 1995).  Similarly, morphological
and structural genomic data have clarified some relationships (Graham et al., 1991;
Manhart and Palmer, 1990; Mishler et al., 1994; Qiu et al., 1998; Sluiman, 1985), but
have been limited by uncertain homology assessment and a limited number of characters.
Phylogenetic relationships among these lineages have been difficult to resolve with
certainty.  In particular, identification of the sister taxon to land plants has been
problematic.
Overview of the Charales
Commonly called stoneworts or brittleworts, the extant Charales are an
evolutionarily important member of the Charophyta.  These algae not only share a close
evolutionary history with land plants but also have a rich fossil record unique among the
charophyte algae (Feist and Grambast-Fessard, 1991; Grambast, 1974; Peck, 1953;
Tappan, 1980).  Natural historians have been attracted to the Charales since the time of
Plinius (1469) and stoneworts later were clearly diagnosed in the herbal of Bauhin
3
(1623), as Equisetum foetidum sub aqua repens (e.g., as a variety of embryophyte).
Vaillant (1721) assigned them to a new genus, Chara, which was later retained by
Linnaeus (1753), who recognized four species.  Currently, the Charales contain one
extant family, the Characeae, in two tribes with six genera: Chareae (Chara,
Lamprothamnium, Lychnothamnus, Nitellopsis) and Nitelleae (Nitella, Tolypella) (Wood,
1965).  Chara and Nitella are relatively species-rich, while the remaining genera contain
only a few (Lamprothamnium and Tolypella) or a single species (Lychnothamnus and
Nitellopsis).
The Charales play a key ecological role in fresh-water streams, ponds, and lakes
throughout the world on all continents except Antarctica (Hutchinson, 1975; Wood,
1965).  They are often the first macrophytic vegetation to occupy new or recently
inundated freshwater bodies (Crawford, 1977; Guerlesquin, 1991; Keiner, 1944; Wade,
1990; Wood, 1952), and sometimes display complex species depth zonation (Blindow,
1992; Corillion, 1957; de Winton et al., 1991; Hutchinson, 1975; Schwarz et al., 2002;
Wood, 1950a).  Stoneworts often form a significant part of the submerged vegetation
stabilizing the sediment (van Nes et al., 2002) and providing food and shelter for other
aquatic organisms (Noordhuis et al., 2002).  While typically found at depths less than 10
meters (Round, 1981), the Charales are often the deepest inhabitants of clear lakes (Dale,
1986; de Winton et al., 1991; Guerlesquin, 1991; Spence and Crystal, 1970; Starling et
al., 1974; Vant et al., 1986) and have been found growing as deep as 60 meters.
The Charales and their extinct relatives left behind a rich and diverse fossil
record, unmatched among the charophyte algae (Feist and Grambast-Fessard, 1991;
Grambast, 1974; Peck, 1953; Tappan, 1980).  This record traces back to the Upper
4
Silurian and includes the earliest known bisexual plant (Feist and Feist, 1997).
Charophyte fossils consist predominantly of female gametangia (oogonia) that when
fossilized are called gyrogonites.  Though relatively rare, fossilized antheridia and
vegetative thalli have been reported (Mart?n-Closas, 1999; Mart?n-Closas and Di?guez,
1998; Taylor et al., 1992).  In addition to the Charales, two extinct orders are recognized,
the Sycidiales and Trochiliscales.  Each order is easily identified by the orientation of
sterile jacketing-cell impressions surrounding the gyrogonite [Sycidiales = vertical,
Trochiliscales = dextral, and Charales = sinistral (Feist and Grambast-Fessard, 1991;
Grambast, 1974; Peck, 1953; Tappan, 1980)].  Three families are currently recognized in
the Sycidiales, two in the Trochiliscales and six in the Charales (Feist and Grambast-
Fessard, 1991).
The Charales span over 390 million years of evolution from the Middle Devonian
to present and include the only extant family (Characeae).  Eochara wickendeni
Choquette from the Middle Devonian (391-370 mya) is the earliest known representative
of the Charales and the only know example of the family Eocharaceae (Choquette, 1956).
Paleochara acadica (Paleocharaceae) from the Pennsylvanian (323-290 mya) is the
single representative of its family, being described from only six specimens from one
location (Bell, 1922).  The Eocharaceae and Paleocharaceae are unique in the Charales in
that they exhibit more than six and just six spiral jacket cells, respectively.  Jacket cell
number in the remaining families, including extant members, is fixed at five.  The
Porocharaceae are first seen in the Late Carboniferous (Pennsylvanian, 323-290 mya) and
the Clavatoraceae appeared in the Late Jurassic (Tithonian, 151-144 mya).  Both of these
families extend to the Late Cretaceous (Maastrichtian, 71.3-65 mya) after which they are
5
no longer found.  At this time, the Raskyellaceae first appear and extend to the Late
Oligocene (Chattian, 28.5-23.8 mya).  Aclistochara from the Late Triassic is the oldest
representative of the Characeae (Liu and Chen, 1992).  The Characeae reached its
greatest generic diversity during the Eocene and Oligocene; however, diversity declined
rapidly in the Miocene eventually stabilizing only six extant genera (Feist and Grambast-
Fessard, 1991).
Numerous morphologically based taxonomic schemes that date back to the older
botanical literature have been proposed for the Charales (Allen, 1954; Groves and
Bullock-Webster, 1920; Groves and Bullock-Webster, 1924; Halsted, 1879; Robinson,
1906; Wood, 1951).  A comprehensive monograph is available and widely used (Wood,
1965), in which a large body of diverse work is summarized and a novel taxonomic
treatment is presented.  This treatment remains controversial after nearly 40 years
because it is founded on gross morphological similarity rather than on shared derived
characters.  Wood (1965) implied that this scheme reflected evolutionary relationships,
but Proctor (1980) pointed out that it was derived from a pre-Darwinian classification
based on convenience, not on phylogenetic inference.  Under this intuitive approach,
approximately 400 Characeae species were reduced to intra-specific ranks (i.e., variety or
forma) or submerged into synonymy resulting in 81 species (Wood, 1965).  This
classification has been widely challenged.  Results from numerous crossing experiments
of Chara species (McCracken et al., 1966; Proctor, 1970; Proctor, 1971; Proctor, 1972;
Proctor, 1975; Proctor, 1980; Proctor et al., 1971; Proctor and Wiman, 1971) suggest that
greater species diversity exists than was proposed in Wood (1965).  Moreover, some
characters (e.g., stipulodes number, cortication) that were used to delineate groups of
6
species (sections and subsections) were demonstrated to be environmentally variable
(Proctor, 1980).  Similarly, diversity within Nitella, a relatively ancient and species rich
group, remains puzzling and poorly understood.  Nitella is relatively difficult to culture
and crossing experiments are needed.
Several molecular-based phylogenetic studies have been published addressing
relationships of genera within the Charales (McCourt et al., 1996a; McCourt et al.,
1996b; Meiers et al., 1997; Sanders et al., 2003), and species within Chara (McCourt et
al., 1999; McCourt et al., in prep; Meiers et al., 1999).  Two recent phylogenetic studies
of Nitella have been published (Sakayama et al., 2004; Sakayama et al., 2002).  Detailed
SEM images of the oospore membrane were presented and the phylogenetic utility of this
character was demonstrated in light of chloroplast gene phylogenies.  Taxa in these
studies, though valuable, were biogeographically restricted to Japan and Malaysia.
More than 180 species of Nitella have been described and Wood (1965) reduced
these to just 19, arguing that many of these species represent a ?continuum of
morphological characters? and that ?isolated populations have contributed to the complex
pattern of morphological variation.?  The chloroplast gene phylogenies of Sakayama et
al., (2004; 2002) clearly refute this notion and demonstrate that worldwide sampling is
greatly needed.  With a clearer understanding of evolution within Nitella, fundamental
classification schemes that are based on natural groups rather than subjective criteria can
be constructed.  In addition, key innovations or processes within Nitella that could help
explain not only evolution of Nitella but also the origin and diversification of land plants
may be identified.  
7
Aims
It is unclear when the lineage leading to land plants diverged from its green algal
ancestor or when they successfully colonized and diversified on the land.  There is no
undisputed fossil of a charophyte older than the Silurian or land plant before the
Ordovician (Graham, 1993; Grey et al., 1982; Kenrick and Crane, 1997a).  Because
primitive plants and most algae do not preserve well in the fossil record, the possibility
exists of an earlier, unrecorded history.  Consequently, information derived from the
fossil record and combined with a robust molecular phylogeny holds strong potential for
understanding the order and timing of these events.  Members of the Charophyta have
been extensively studied as model organisms in such diverse fields as cell biology,
conservation, ecology, molecular biology, and paleobotany.  Systematic studies (in
particular phylogenetic trees) provide fundamental historic data that can be used in
virtually all fields of biology.  They can serve to unite seemingly disparate areas of
biology towards a better evolutionary understanding of this important eukaryotic lineage.
In this dissertation, the evolutionary history of the Charales was investigated by
means of several interrelated phylogenetic analyses.  First, a multi-gene phylogenetic
analysis is presented to address the phylogenetic position of the Charales in the larger
scheme of green plant evolution.  Second, data derived from the Charales fossil record
are combined with DNA sequence data to estimate the absolute divergence times of the
extant members of the Charophyta.  Finally, a phylogenetic framework for the genus
Nitella is presented.  This study includes a broad representative of species from around
the world and serves as a starting point for testing the classification scheme of Wood
(1965).
8
Chapter II:  The closest living relatives of land plants
Introduction
 The evolutionary origin of the land plants (or embryophytes) from their green
algal ancestor was a pivotal event in the history of life.   This monophyletic group,
including bryophytes, pteridophytes, and seed plants, has altered the biosphere and now
dominates the terrestrial environment, but uncertainty as to the identity of their closest
living relatives persists in the literature after more than a century of scrutiny (Bower,
1908; Graham, 1993; Kenrick and Crane, 1997a).  Morphological and molecular studies
have identified two distinct lineages within the green plants sensu lato, termed
Charophyta and Chlorophyta.  The Charophyta comprise the land plants and at least five
lineages (orders) of fresh water green algae (Figure II-1) the latter recognized as the class
Charophyceae (Mattox and Stewart, 1984; Pickett-Heaps and Marchant, 1972).  The
Charophyta are sister to the Chlorophyta, which consist of essentially all other green
algae.  Previous molecular analyses have verified monophyly of most of the charophyte
orders (Chapman et al., 1998; Gontcharov et al., 2003; Marin and Melkonian, 1999;
McCourt et al., 2000), but branching patterns among these lineages have been only
weakly supported, with results that were sensitive to taxon selection and method of
phylogenetic reconstruction (McCourt, 1995).  Similarly, analyses of morphological and
genome structural data have clarified some relationships (Graham et al., 1991; Manhart
and Palmer, 1990; Mishler et al., 1994; Qiu et al., 1998; Sluiman, 1985), but have been
limited by the number of available characters, number of genomes sequenced, uncertain
homology assessment, and a lack of character independence.
9
Figure II-1.  Representative green algal species in the Charophyta.  (1a), Chara
globularis (Charales) KGK0044, showing cortication of developing oogonium and
antheridium in the background.  Freshwater, scale bar 1 mm.  (1b), Coleochaete
pulvinata (Coleochaetales) CFD 56a6, showing early developmental stage of zygote
cortication.  Freshwater, scale bar 30 ?m.  (1c), Spirogyra maxima (Zygnematales)
UTEX 2495, showing conjugation tubes and partially developed zygotes.  Freshwater,
scale bar 100 ?m.  (1d), Klebsormidium nitens (Klebsormidiales) SAG 335-2b, showing
a single parietal chloroplast per cell. Moist soils or freshwater, scale bar 30 ?m.  (1e),
Chlorokybus atmosphyticus (Chlorokybales) UTEX 2591 growing in characteristic
sarcinoid packets of cells.  Moist soils, scale bar 10 ?m.  (1f), Mesostigma viride
(Mesostigmatales) SAG 50-1.  Note surface scales visible on upper portion of cell;
flagella are not visible, but would emerge from the medial groove in direction of viewer.
Freshwater, scale bars 10 ?m.  Micrographs 1b and 1c-1f kindly provided by C. F.
Delwiche and 1c by C. S. Drummond.
10
11
It is not surprising that identifying the closest living relatives of land plants has
been difficult.  Roughly 470 million years of evolution since the colonization of the land,
coupled with rapid radiation and numerous extinction events (Feist and Grambast-
Fessard, 1991; Graham, 1993; Grambast, 1974; Kenrick and Crane, 1997a; Peck, 1953),
has resulted in an inherently difficult phylogenetic problem.   Under such conditions,
homology assessment can be difficult and phylogenetic reconstruction complex
(Felsenstein, 1978).  Other factors complicating this phylogenetic problem are the
relatively weak signal from any single gene, and unrealistic assumptions made by some
analytical methods.  It is possible to compensate in part for these difficulties with
thorough taxon sampling (Rannala et al., 1998) (to the extent possible given extinction),
combined with a relatively large number of characters from concatenated genes (Graham
and Olmstead, 2000; Lemieux et al., 2000; Pryer et al., 2001; Qiu et al., 1999; Soltis et
al., 1999; Turmel et al., 2002b) and methods of phylogenetic reconstruction that
incorporate biologically meaningful models (Hillis et al., 1994).  Here a molecular
phylogenetic analysis is presented using DNA sequence data from four genes
representing three plant genomes: atpB and rbcL (plastid), nad5 (mitochondrial), and
SSU rRNA gene sequences (nuclear) and the implications of this phylogeny are
considered to address the evolutionary origin of land plants and to identify the closest
living relatives of this group.
12
Materials and Methods
DNA isolation, PCR, and sequencing
Total cellular DNA was isolated by the CTAB method (Doyle and Doyle, 1987),
UNSET method (a high-urea, SDS extraction buffer) or using the Nucleon Phytopure
resin-based extraction kit following the protocol provided for small samples (Amersham
Pharmacia, Uppsala, Sweden).   Thalli were acquired either from cultures growing in uni-
algal condition or from nature.  Contaminating epiphytes were removed from natural
collections and cleaned thalli were placed at ?20? C until time of extraction.  In total,
thirty-four representative charophytes were sampled, including eight land plants, as well
as six outgroup taxa.  A summary of species, source, and GenBank accession numbers is
shown in Table II-1.
13
TABLE II-1.  Lists of species, source, and GenBank accession numbers.  The column
labeled ?nrSSU ? total/unamb.? shows total number of conflicting characters
(unambiguous, ambiguous, and inferred indels) compared to published sequences, and
total differences comparing only unambiguous characters between new and published
sequences.  All comparisons reflect sequences determined from the identical algal strain
or DNA extraction as the published sequence.  ?na? = not applicable.
StrainatpBrbcLnad5nrSSU
nrSSU ?
total/unamb.
Land plants
 Arabidopsis thalianaAP000423AP000423NC001284AC006837na
 Taxus spp. AJ235619AJ235811AJ000705D16445na
 Psilotum nudumU93822U30835AJ012794U18519na
 Dicksonia antarcticaU93829U05919AJ130745U18624na
 Huperzia spp. U93819X98282AJ012795U1850na
 Sphagnum spp. AF313557L13485AJ001225Y11370na
 Anthoceros/Phaeoceros spp. D86545D43696AJ000698U18491na
 Marchantia polymorphaX04465X04465NC001660AB021684na
Charales
 Chara connivensF140AF408782AF097161AF408200AF408223na
 Lamprothamnium macropogonX695AF408783U27534AF408201AF40822416/6
 Lychnothamnus barbatus159AF408784AF097171AF408202AF408225na
 Nitellopsis obtusaF131BAF408785U27530AF408203AF408226na
 Nitella opacaF146AF408786AF097174AF408204AF408227na
 Tolypella proliferaF150AF408787AF097175AF408205AF408228na
Coleochaetales
 Coleochaete orbicularisUTEX LB 2651AF408788L13477AF408206AF40822928/14
 Coleochaete solutaCFD 32d1AF408789AF408247AF408207AF408230na
 Coleochaete irregularisCFD 3d2AF408790AF408248AF408208AF408231na
 Coleochaete sieminskianaCFD 10d1AF408791AF408249AF408209AF408232na
 Chaetosphaeridium globosumSAG 26.98AF408792AF408250AF408210AF113506
4
na
 Chaetosphaeridium ovalisCFD 5c1AF408793AF408251AF408211AF181094na
Zygnematales
 Zygnema peliosporumUTEX LB 45AF408799U38701AF408215AF408238na
 Spirogyra maximaUTEX LB 2495AF408797L11057ndAF408236na
 Mougeotia sp.UTEX LB 758AF408800AF408252AF408216AF408239134/>50
 Mesotaenium caldariorumUTEX 41AF408798U38696ndAF40823710/2
 Gonatozygon monotaeniumUTEX LB 1253AF408796U71438AF408214AF408235na
 Onychonema spUTEX LB 832AF408794AF203501AF408212AF408233na
 Cosmocladium perissumUTEX LB 2447AF408795AF203494AF408213AF408234na
Klebsormidiales
 Klebsormidium flaccidumUTEX LB 2017AF408801L13478AF408217AF4082406/0
 Klebsormidium subtilissimumUTEX 462AF408802AF408253AF408218AF408241na
 Klebsormidium nitensSAG 335-2bAF408803AF408254AF408219AF4082421/0
 Entransia fimbriataUTEX LB 2353AF408804AF203496AF408220AF408243na
Chlorokybales
 Chlorokybus atmosphyticusUTEX LB 2591AF408805AF408255AF408221AF40824414/3
Mesostigmatales
 Mesostigma virideSAG 50-1AF408806AF408256AF408222AF4082453/2
 Mesostigma virideAF166114AF166114AF353999AJ250109na
14
StrainatpBrbcLnad5nrSSU
nrSSU ?
total/unamb.
Outgroups
 Volvox carteriAB013999D63446ndX53904na
 Chlamydomonas spp.M13704J01399U03843U70786na
 Paulschulzia pseudovolvoxUTEX 167AB014040D86837ndAF408246na
 Pteromonas spp.AB014038AJ001887ndX916270/0
 Nephroselmis olivaceaNC000927NC000927NC000892X74754na
 Cyanophora paradoxaU30821U30821unpublishedX68483na
15
The polymerase chain reaction (PCR) with gene specific primers was used to
amplify each of the four genes.  The resulting PCR products were purified using a
polyethylene glycol (PEG) precipitation (Morgan and Soltis, 1993).  Sequences were
determined on both strands with the PCR primers and internal sequencing primers.
Several particularly divergent sequences required sequence-specific internal primers
(Table II-2).  Sequencing reactions were performed with the BigDye Terminator Ready
Reaction Kit v2.0 according to the manufacturer?s protocol (Perkin Elmer Biosystems,
Foster City, CA) and resolved using either an ABI-PRISM 377 or 3100 DNA sequencer.
The resulting sequence chromatograms were edited and compiled into a single alignment
using Sequencher 3.1.1 (Gene Codes Corporation, Ann Arbor, MI) and exported in
NEXUS format for phylogenetic analyses.  Many previously published SSU rRNA gene
sequences were difficult to align to putative secondary structure models and were re-
sequenced for this study (Table II-1).  For re-sequenced individuals the SSU rRNA gene
was amplified on two ways, (1) with PCR primers used to amplify the original sequence
Table II-2), and (2) with primers used for all new SSU sequences in this study.  Each
amplicon was sequenced separately and then compared.  With this procedure, the
possibility of primer-specific amplification could be eliminated.  Careful attention was
made to re-sequence the SSU rRNA genes from either identical strain material or the
DNA extraction used to generate the original sequence.
16
Table II-2.  PCR and sequencing primers used in this study.  A single asterisks ?*?
indicates primers used for both PCR and sequencing.  A double asterisk ?**? denotes
primers used only for sequencing.
GenePrimer sequence 5?-3'Taxon Range
atpB
 175 Forward*TGTTACTTGTGAAGTTCAACAUniversal
 1404 Reverse*CTAAATAAAATGCTTGTTCAGGUniversal
 835F**GCTGGTTCGGAAGTTTCTGCUniversal
 722R**GGAGGCTCATTCATTTGACCUniversal
 865F**TACTGTGCTTTCTCGTAATCCharaceae
 901R**ATAGTAGAAGTAGAATCAAGCharaceae
 835F**GCAGGATCCGAGGTGTCTGCMougeotia
 722R**GGTGGTTCGTTCATCTGACCMougeotia
rbcL
 RH1 Forward*ATGTCACCACAAACAGAAACTAAAGCUniversal
 1385 Reverse*AATTCAAATTTAATTTCTTTCCUniversal
 715F**TATCTGAATGCTACTGCTGGUniversal
 734R**CCAGCAGTAGCATTCAGATAUniversal
 670F**GCAATTTATAAATCTCAAGCAGCharaceae
 751R**GCATTTCTTCACAAGTTCCTGCharaceae
nad5
 nad5 Forward*GTAGGTGATTTTGGATTAGCUniversal
 nad5 Reverse*GTACCTAAACCAATCATCATATCUniversal
 946F**ACTTGTAGTCAATTAGGTTATATGUniversal
 1109R**CCCATTTTTCGCATATCTTGTTCATCUniversal
 Klebnad5F**ATGAACCATGCTTTTTTTAAAGCKlebsormidium
 Klebnad5R**GACATTGCATGAATTACAGACCCAGKlebsormidium
 Entnad5R**GCATGAATAACGGATCCGGCACEntransia
SSU
 Medlin-5?AACCTGGTTGATCCTGCCAGTUniversal
 Medlin-3?TGATCCTTCTGCAGGTTCACCTACUniversal
 Wilcox-5?CTGGTTGATCCTGCCAGTAGUniversal
 Wilcox-3?TGATCCTTCTGCAGGTTCACUniversal
 NS1*GTAGTCATATGCTTGTCTCUniversal
 C-nc18S10*CTTGTTACGACTTCTCCTUniversal
 N-nc18S4**TGCAGTTAAAAAGCTCGTUniversal
 C-nc18S4**ACGAGCTTTTTAACTGCAUniversal
 N18I**AATTTGACTCAACACGGGUniversal
 C18I**CCCGTGTTGAGTCAAATTUniversal
17
A single intron was found in the Coleochaete orbicularis nad5 sequence that was
not found in any other charophyte green algal sequence.  Introns with the same insertion
point were previously identified in nad5 sequences from the liverwort Marchantia and
the moss Sphagnum (Beckert et al., 1999).   An intron of similar size, but different
insertion point, was also found in Anthoceros (a hornwort).  Homology of these introns
was assessed by calculating pair-wise similarity values using the program ?GAP? found in
the GCG computer package of programs (GCG, 2000).  For comparison, random
sequences with similar base composition and length to each natural sequence were
generated with MacClade v4.01 (Maddison and Maddison, 2001) and also analyzed using
GAP.
Phylogenetic analyses
Bayesian inference (BI) (Huelsenbeck and Bollback, 2001; Huelsenbeck et al.,
2001; Larget and Simon, 1999; Rannala and Yang, 1996) was carried out using MrBayes
v2.0 (Huelsenbeck and Ronquist, 2001).  MrBayes uses a Metropolis-coupled Markov
chain Monte Carlo (or MCMCMC) algorithm that runs several chains simultaneously.
Two separate runs were carried out with four Markov chains, each starting from a
random tree.  Three of these chains were heated allowing for broad sampling of
parameter space while the forth chain was not.  The Markov chains were run for two
million generations sampling every 100 generations for a total of 20,000 samples each
run.  The first 1,000 samples from each run were discarded as burn-in (data points
sampled before the chain reaches stationarity), and the remaining 38,000 samples (19,000
from each run) were combined into a single file and analyzed using the 'sumt' command
18
in MrBayes.  Both independent runs found essentially identical tree topologies and
posterior probabilities (not shown), indicating that the sample number was sufficient to
permit the algorithm to converge on a global solution.
Maximum likelihood (ML) analyses were carried out using PAUP* v4.0b8
(Swofford, 1998).  Using the likelihood ratio test statistic, model selection procedures
(Goldman, 1993) identified the general-time-reversible model (Yang, 1994a) with
invariable sites (Hasegawa et al., 1985) and gamma-distributed rates (Yang, 1994b) for
variable sites (GTR+I+?) as the best-fitting model.  With model parameters estimated
from the data, a heuristic search with ten random taxon addition sequences, TBR branch
swapping, and steepest descent option active was performed.  Bootstrap analyses were
conducted using 500 resampling replicates generated by CodonBootstrap v3.0b4
(Bollback, 2001) taking into account protein-coding and ribosomal portions of the
dataset.  For each bootstrap replicate, a heuristic search with three random taxon addition
sequences, NNI branch swapping, and steepest descent option active was performed.
Analyses using maximum parsimony (MP), and minimum evolution (ME) with
two distance measures (LogDet [ME-ld] and maximum likelihood [GTR+I+?; ME-ml]
distances) were also performed using PAUP*.  For both MP and ME analyses, a heuristic
search was performed with ten random taxon addition replicates, TBR branch swapping,
and steepest descent option active.  Bootstrap analyses were conducted using 1,000
resampling replicates.
The Kishino-Hasegawa (KH) test (Kishino and Hasegawa, 1989) was used to
evaluate differences between the best phylogeny with those corresponding to alternate
hypotheses.  Two alternative hypotheses of the sister taxon to the land plants were
19
evaluated: (1) Coleochaetales sister to land plants, and (2) Charales sister to
Coleochaetales and these sister to land plants.  Bayesian posterior probabilities and
bootstrap analyses permit evaluation of alternative hypotheses and both were used to
evaluate these alternative hypotheses.
Results
Taxa and data set
The data set used for phylogenetic analyses excludes introns and unalignable
regions for a total length of 5,147 base pairs.  Unalignable regions included a forty-five-
character region of nad5 and a five, three, and six character region of the SSU gene, all of
which corresponded to putative loop regions.  Mean base composition across taxa and
number of parsimony informative characters for each gene and the combined data set are
presented in Table II-3.
20
Table II-3.  Mean base composition values across taxa, parsimony informative characters
(PIC), parsimony uninformative characters (PUC), constant characters (CC), and total
characters (Total) for atpB, rbcL, nad5, SSU and all four genes combined.
%A%C%G%TPICPUCCCTotal
atpB31172131555625891,206
rbcL28182331593836771,353
nad524192037443123175741
SSU252128 3292111,3071,847
All data271923
26
3119204792,7485,147
21
A single intron was identified in the Coleochaete orbicularis nad5 sequence that
was not found in any other species of Coleochaete or any other algal charophyte nad5
sequence sampled.  Introns with the same insertion point as that of C. orbicularis were
previously identified in Sphagnum and Marchantia (Beckert et al., 1999) and sequence
identity scores (Table II-4) generated using ?GAP? revealed of 69.39% identity between
Sphagnum and Marchantia.  These sequences compared with C. orbicularis shared only
37.82% and 37.81%, respectively.  Anthoceros has an apparently unrelated intron
inserted 128 base pairs downstream with 37.35% identity with that of Sphagnum, 35.99%
identity to Marchantia, and 39.46% to C. orbicularis.  For comparison, pairs of random
sequences with similar base composition and length as the natural sequences had an
average of 37.78% sequence identity.  These data not only confirm the independent
origin of the intron found in Anthoceros but also suggest that the C. orbicularis nad5
intron was acquired independently from that shared by Sphagnum and Marchantia.
The best fitting likelihood model of sequence evolution as determined with the
likelihood ratio test was the general-time-reversible model with invariable sites and a
gamma distributed correction for rate variation among variable sites (GTR+I+?).  The
parameter estimation procedure converged on identical values after two iterations and
these values were fixed for both ML and ME-ml analyses.  ME-ld analyses used the same
fraction of invariant sites (I=0.388199) estimated my ML.  In the following discussion,
PP = Bayesian posterior probability; BS = bootstrap support.
22
TABLE II-4.  Pair-wise comparisons of nad5 intron sequences.  Percent similarity
between Coleochaete orbicularis (1), Marchantia, Anthoceros, Sphagnum, and four
random sequences of similar base composition and length as the natural sequences (*).
Coleochaete
1
MarchantiaAnthocerosSphagnumColeochaete*Marchantia*Anthoceros*Sphagnum*
Coleochaete
1
- 37.82836.61737.82337.07242.47135.12038.122
Marchantia- 35.92869.36036.36439.84136.67738.623
Anthoceros- 37.34936.96936.96336.98836.461
Sphagnum - 40.11137.16436.57436.091
Coleochaete* - 40.60239.55641.155
Marchantia* - 40.14940.625
Anthoceros* - 36.232
Sphagnum* -
23
Using BI and ML on the combined four-gene data set (Figure II-2), the order
Charales was found sister to the land plants with strong statistical support (PP=1.0,
BS=94) and a monophyletic Coleochaetales sister to the Charales/land plant clade
(PP=1.0, BS=59).  The MP and ME analyses (Figure II-3) also support the result that
Charales have a closer relationship to land plants than do Coleochaetales (MP=80, ME-
ld=97, ME-ml=92).  The overall structure of the best tree is consistent with previous
work in that the classically recognized orders were also recovered (land plants, PP=1.0,
ML=100, MP=100, ME-ld=100, ME-ml=100; Charales, PP=1.0, ML=100, MP=100,
ME-ld=100, ME-ml=100; Coleochaetales, PP=1.0, ML=62, MP=<50, ME-ld=75, ME-
ml=<50; Zygnematales, PP=1.0, ML=99, MP=93, ME-ld=68, ME-ml=<50; and
Klebsormidiales PP=1.0, ML=100, MP=100, ME-ld=100, ME-ml=100).  There was also
support for placement of the enigmatic filamentous alga Entransia (McCourt et al., 2000)
with the Klebsormidiales (PP=1.0, ML=77, MP=77, ME-ld=<50, ME-ml=64).  The rare,
monotypic genus Chlorokybus was found sister to the remainder of the unambiguous
charophytes, while all analyses strongly support the inclusion of Mesostigma within the
Charophyta (PP=1.0, ML=97, MP=100, ME-ld=100, ME-ml=100).
24
FIGURE II-2.  Phylogenetic relationships for the Charophyta determined by Bayesian
inference from the combined four-gene data set.  The maximum likelihood tree (-ln =
64499.87863) was of identical topology.  Posterior probabilities are noted above branches
and maximum likelihood bootstrap values are below branches.  The topology is drawn
with Cyanophora rooting the tree. Branch lengths are Bayesian mean values and are
proportional to the number of substitutions per site (scale bar, 0.05 substitutions/site).
Taxonomy is modified from Mattox and Stewart (1984).
25
26
FIGURE II-3.  Phylogenetic relationships of the Charophyta inferred from the combined
four-gene data set using additional analytical methods.  Bootstrap values (1000
replicates) are shown above branches. An asterisk '*' denotes bootstrap values below
50%.  (a) Maximum parsimony tree (tree score, 12,365 steps; scale bar, 100
substitutions).  (b) Minimum evolution tree using LogDet distances (tree score, 2.50594;
scale bar, 0.05 substitutions/site).   (c) Minimum evolution tree using maximum
likelihood distances (tree score, 3.57107; scale bar, 0.05 substitutions/site).  ** Bootstrap
value for a very short branch uniting Chlorokybus with the remaining traditional
charophyte lineages excluding Mesostigma.  The topologies are drawn with Cyanophora
rooting the trees.  Taxonomy is modified from Mattox and Stewart (1984).
27
28
29
30
Results from the KH test rejected both the Coleochaetales sister to land plants
(P=0.0014) and the Coleochaetales sister to Charales (P=0.0040) in favor of Charales
sister to land plants (Figure II-4).  Both Bayesian posterior probabilities and bootstrap
analyses were unable to identify either of these alternative hypotheses with non-trivial
support: Coleochaetales sister to land plants, PP=0.0, BS=0.0%; Coleochaetales sister to
Charales, PP=0.0, BS=0.4%.  Bayesian posterior probabilities and bootstrap analyses
were also examined for Coleochaete orbicularis sister to land plants, PP=0.0, BS=0.0%;
and Coleochaete sister to land plants, PP=0.0, BS=0.0%.  Taken together, these results
strongly support the placement of the Charales sister to the land plant and reject the
above-mentioned alternative hypotheses.
31
FIGURE II-4.  Kishino-Hasegawa test results for alternate hypotheses of the sister taxon
to land plants.  Inset trees diagram alternative hypotheses for relationships among land
plants (LP), Charales (Ch) and Coleochaetales (Co).  (a) Preferred hypothesis generated
by both Bayesian inference and maximum likelihood analyses.  The log likelihood (ln L)
was determined with PAUP* using the GTR+I+? model of sequence evolution.  (b)
Alternate hypothesis 1 showing the maximum likelihood topology constraining
Coleochaetales to be sister to land plants.  The ? ln L value indicates the difference in log
likelihood relative to the preferred hypothesis and the P value represents the probability
of getting a more extreme t-value under the null hypothesis of no difference between the
two hypotheses (significant at P < 0.05, one-tailed test).  (c) Alternate hypothesis 2
constraining Charales and Coleochaetales to be monophyletic and sister to land plants.
Scale bar is equal to 0.05 substitutions/site.
32
33
Discussion
Both Charales and Coleochaetales have long been considered to be close relatives
of the land plants (Bower, 1908; Fritsch, 1935; Graham, 1993; Kenrick and Crane,
1997a; Mattox and Stewart, 1984; Pickett-Heaps and Marchant, 1972). Key
morphological characters uniting these three lineages include branched filamentous
growth, oogamous sexual reproduction, and phragmoplastic cell division, along with a
suite of ultrastructural and biochemical features (Graham and Wilcox, 2000).  In light of
similar morphological traits (i.e., parenchyma-like tissue, placental transfer cell wall
ingrowths and zygote retention), the genus Coleochaete and, in some instances, a single
species, C. orbicularis, has been discussed as a possible sister taxon to land plants
(Graham et al., 1991; Mishler et al., 1994).  The results here indicate that the
Coleochaetales are monophyletic and less closely related to the land plants than the
Charales.
The Charales also share numerous characteristics with land plants, some of which
are not found in the Coleochaetales.  These include gross sperm morphology and
ultrastructure (Duncan et al., 1997; Steil, 1941), numerous discoidal chloroplasts per cell,
protonemal filaments, complete absence of zoospores (sperm are the only flagellate
cells), and encasement of the egg by sterile jacket cells (cortication) prior to fertilization
(Fritsch, 1935; Graham and Wilcox, 2000).  The results of this study suggest that many of
the similarities between Charales and land plants may reflect homology rather than
convergent evolution.  Cortication of the zygote reminiscent of that in Charales is found
in some species of Coleochaete, but occurs only after fertilization of the egg, and zygote
cortication is not thought to occur in Chaetosphaeridium (Thompson, 1969).  In addition,
34
primary plasmodesmata have been confirmed in the Charales, a character shared with
land plants (Cook et al., 1997).  Although plasmodesmata have been described in
Coleochaete (Stewart et al., 1973), it is unknown whether their development is primary or
secondary in nature.
The phylogenetic placement of Mesostigma, a unicellular, scaly green flagellate
has been controversial and the results presented here shed light on this problem.
Traditionally classified with like forms as a prasinophyte, the identification of a land-
plant-like MLS led to the suggestion that Mesostigma may be more closely allied with the
Charophyta than to other scaly flagellates (Melkonian, 1989; Rogers et al., 1981).  Like
the results presented here, analyses of actin sequences placed Mesostigma at the base of
the Charophyta (Bhattacharya et al., 1998), and analyses of SSU rRNA gene sequence
data place it among them (albeit in close association with Chaetosphaeridium, a grouping
not supported by other data) (Gontcharov et al., 2003; Marin and Melkonian, 1999;
Sluiman and Guihal, 1999).  By contrast, maximum likelihood analyses of amino-acid
data from both the plastid and mitochondrial genomes of Mesostigma find strong support
for placement of this genus as sister to all green algae rather than as a basal charophyte
lineage (Lemieux et al., 2000; Turmel et al., 2002b).  The latter analyses differ from those
presented here in the number of characters and taxa sampled (eight vs. forty).  When
divergence times are large and internal branches short, limited taxon sampling can lead to
inaccurate phylogenies (Felsenstein, 1978).  If taxon sampling explains this conflict, then
one would predict convergence on the phylogeny presented here as additional organellar
genomes become available.  The phylogenetic position of Mesostigma is critical to
35
understanding the evolution of form and structure in the lineage that gave rise to land
plants and warrants further research.
Identification of the Charales as the sister taxon to land plants with the
Coleochaetales as sister to the Charales/land plant clade suggests that the common
ancestor of land plants was a branched, filamentous organism with a haplontic life cycle
and oogamous reproduction.  The early stages of development in the Charales involve
formation of protonemal filaments reminiscent of those found in some mosses and other
land plants, which suggests that a similar heteromorphic development might have
occurred in the common ancestor.  Other characteristics of this ancestor, including both
developmental and biochemical features, may explain not only how their descendants
came to survive on land, but also how they ultimately came to dominate terrestrial
ecosystems.  Moreover, the charophytes have important applications in a wide range of
disciplines (Charales in cell biology, Coleochaetales in ultrastructure, and Zygnematales
in physiology) (Graham and Wilcox, 2000). Consequently, a robust phylogeny relating
these taxa to land plants can place this work in an evolutionary context and lead to the
identification and development of appropriate model systems for future studies.
Although it is tempting to envision the origin of land plants as having been from
amorphous pond scum, these data indicate that the common ancestor of land plants and
their closest algal relatives was a relatively complex organism.  The extant Charales are
the remnants of a once diverse, but now largely extinct, group which includes some of the
oldest known plant fossils (roughly 420 ma, from the late Ordovician) (Feist and
Grambast-Fessard, 1991; Grambast, 1974).  While the fossil record for the other
charophyte orders is fragmentary at best (Tappan, 1980), the molecular phylogenetic data
36
presented here (Figure II-2, II-3) suggests that these lineages diversified more than 470
ma.  While not species rich, these algae hold a key position in the tree of life and,
consequently, represent an important part of eukaryotic diversity.
37
Chapter III:  Estimating divergence times in the Charophyta
Introduction
Overview
One of the key events in the history of life was undoubtedly the transition of
green algae from their aquatic environment to the land, an event that occurred at least half
a billion years ago.  This transition and the succeeding diversification not only modified
the atmosphere and transformed the physical landscape, but also set the stage for
subsequent diversification of numerous other organisms.  Botanists, paleontologists and
molecular biologists alike have spent considerable energy toward understanding the
patterns and processes involved in the evolutionary origin of land plants.  Nevertheless,
our knowledge of this event has been hampered by two key problems: 1) Circumscription
and phylogenetic relationships among extant algal lineages and land plants have been
difficult to resolve both with morphology and single-gene data sets (see Chapter II and
references therein), and 2) early land plant fossils are inadequate to reconstruct early
stages of land plant ancestry (Graham, 1993; Kenrick and Crane, 1997a).
Recent theoretical and technological innovations coupled with improved
understanding of green plant diversity have permitted collection and analysis of
molecular data (DNA sequences) that more fully represent extant diversity within the
green plant lineage Charophyta (Graham and Olmstead, 2000; Lemieux et al., 2000;
Pryer et al., 2001; Qiu et al., 1999; Qiu et al., 2001; Soltis et al., 1999; Turmel et al.,
2002b).  This monophyletic group includes at least six green algal lineages, Charales,
Coleochaetales, Zygnematales, Klebsormidiales, Chlorokybales, and Mesostigmatales, as
38
well as land plants (embryophytes).  The four-gene phylogentic analysis discussed in
Chapter II presents the first strongly supported evolutionary hypothesis of the early
branching events in the Charophyta and identifies the Charales as the sister taxon of land
plants.  With a robust phylogeny that identifies the branching order among these lineages,
it is possible to estimate when the now-extinct ancestors of these lineages diverged and in
the process began diversification of what is now the dominant form of terrestrial life.
A common approach, albeit a source of substantial controversy as well, is the use
of molecular sequence data to estimate divergence times.  Zuckerkandl and Pauling
(1962; 1965) were the first to suggest that molecular sequence data might evolve at rates
constant enough that molecular divergence measures could be used to calibrate a
?molecular clock.?  This assumes that the rate of molecular sequence change is constant
across lineages and over time.  Under this model, a measurement of the molecular
sequence difference between any two lineages would reveal how long ago these lineages
diverged from their common ancestor.  Numerous studies have used the molecular clock
model in attempts to estimate divergence times (Arnason et al., 1998; Cooper and Penny,
1997; Glazko and Nei, 2003; Goremykin et al., 1997; Heckman et al., 2001; Hedges et
al., 1996; Wray et al., 1996).
There are, however, considerable problems associated with estimating divergence
times under a strict molecular clock (Ayala, 1997; Fitch, 1976; Hillis et al., 1996).  A
strict clock depends on a uniform substitution rate across lineages and an accurate
calibration date for at least one speciation event.  However, molecular data sets rarely
exhibit constant substitution rates across all taxa (Britten, 1986; Gillespie, 1991; Gissi et
al., 2000; Li and Tanimura, 1987; Sanderson and Doyle, 2001).  Several methods have
39
been proposed that attempt to compensate for this.  Relative rate tests have been used to
identify lineages that significantly deviate from the clock, and once identified, these
lineages can be selectively removed before divergence times are estimated (Kooistra and
Medlin, 1996; Russo et al., 1995; Takezaki et al., 1995).  An obvious drawback to this
approach is the loss of data that may be directly pertinent to the question at hand.
Another approach invokes ?local clocks? by applying different rate parameters to
different parts of the tree (Hasegawa et al., 1989).  However, without prior knowledge it
might become difficult to identify where or how many local clocks should be placed on a
tree.  The extreme case would apply separate rate parameters on each branch of the tree;
because rate and time are confounded, in this case divergence time estimates would
become impossible to calculate.  Sanderson (1997) introduced a nonparametric method
for smoothing the differences in rates across speciation events on a tree.  This method has
the advantage of allowing rates to vary on branches while allowing divergence times to
be estimated.  A similar parametric method has been developed that uses a Bayesian
approach for multi-gene data sets (Kishino et al., 2001; Thorne and Kishino, 2002;
Thorne et al., 1998).  This method, like Sanderson?s, assumes that rates are autocorrelated
across speciation events; sequences from closely related lineages are assumed to evolve
at more similar rates than those from distantly related lineages.  Under a Bayesian
framework, this method is conditioned on the data and tree topology while integrating
over uncertainty in branch lengths, degree of autocorrelation, substitution model
parameters, and error associated with fossil calibration dates.
Another important factor that influences the accuracy of divergence time
estimates is reliability of the calibration point(s) used for producing the time scale and the
40
distribution of these calibration points on the phylogenetic tree.  Use of calibration points
derived from the fossil record assumes that those fossils not only provide an accurate
account of the evolutionary history of that lineage but also that the age estimate of the
fossil is accurate.  Typically, the first occurrence of a taxon in the fossil record is used as
a minimum estimate of that lineage?s divergence time and should not be interpreted as a
maximum age (Doyle and Donoghue, 1993).  Upper and lower bounds can be defined to
more accurately incorporate the error associated with fossil dates (Sanderson, 1997;
Thorne and Kishino, 2002).
The fossil record
Unique among the charophyte algae, a rich and extensively studied fossil record
exists for the Charophyceae, here defined as the Charales Lindley and two other orders
found exclusively in the fossil state, the Trochiliscales M?dler and the Sycidiales M?dler.
Charophyte fossils predominantly consist of the remains of female gametangia (oogonia),
called gyrogonites.  Oogonia are spherical bodies composed of the single-celled oospore
tightly surrounded by a single rank of sterile jacketing cells terminated apically by a set
of coronular cells.  A basal plate (either one or three sterile sister cells of the oospore),
node cell and finally the basal pore subtend the oospore.  The oospore itself is invested
with a thick layer of sporopollenin, a highly durable material.  Complete fossil oogonia
are rarely found.  Rather, the thickened sporopollenin impregnated oospore membrane
with calcified jacket-cell remnants, along with the basal plate impressions, is generally
preserved.  The orientation of the jacketing cells enclosing the oospore easily
differentiates the three orders from one another (Sycidiales, vertical cells; Trochiliscales,
dextral cells; Charales, sinistral cells).  Fossilized antheridia or vegetative thalli are rarely
41
seen, but when they are encountered they occur as long internodal cells alternating with
short nodal cells bearing whorls of branchlets, which is the arrangement also found in all
extant forms (Edwards and Lyon, 1983; Mart?n-Closas, 1999; Mart?n-Closas and
Di?guez, 1998; Taylor et al., 1992).  The presence of sporopollenin in close relatives of
the Charophyceae suggests that even the earliest members of this lineage would be
capable of fossilization (Delwiche et al., 1989; Graham, 1993; Kroken et al., 1996).
From these fossils, three families are currently recognized in the Sycidiales, two
in the Trochiliscales, and six in the Charales (Feist and Grambast-Fessard, 1991).
Praesycidium siluricum Ishchenko and Ishchenko (Sycidaceae: Sycidiales), from the Late
Silurian (Pridolian, 419-417 mya) of Podolia (southwestern Ukraine), is the oldest
charophyte species known (Ishchenko and Ishchenko, 1982).  Trochiliscus
(Eutrochiliscus) podolicus Croft (Trochiliscaceae: Trochiliscales), from the Early
Devonian (417-391 mya) of Podolia in Eastern Europe, is the oldest representative of the
Trochiliscales (Croft, 1952).  Both of these orders persist in the fossil record over
relatively short geologic ranges and are not found after the Late Devonian or Early
Mississippian (Grambast, 1974).
Within the Charales, six families are recognized and include the only extant
family (Characeae).  Eochara wickendeni Choquette (Eocharaceae), from the Middle
Devonian (391-370 mya) of Canada, is the earliest known representative of the Charales
and the only known example of this family (Choquette, 1956).  Paleochara acadica Bell
(Paleocharaceae), from the Pennsylvanian (323-290 mya) of Nova Scotia, Canada, is the
single representative of this family, being described from only six specimens from the
same location (Bell, 1922).  The Eocharaceae and Paleocharaceae are unique in the
42
Charales in that they exhibit more than six and exactly six spiral jacket cells, respectively.
Jacket cell number in the remaining families is fixed at five.  The Porocharaceae are first
seen in the Late Carboniferous (Pennsylvanian, 323-290 mya) and the Clavatoraceae
appear in the Late Jurassic (Tithonian, 151-144 mya).  Both of these families extend to
the Late Cretaceous (Maastrichtian, 71.3-65 mya).  At this time, the Raskyellaceae first
appear and extend to the Late Oligocene (Chattian, 28.5-23.8 mya).  Aclistochara, from
the Late Triassic, is the oldest representative of the Characeae (Liu and Chen, 1992).
This family reached its greatest generic diversity during the Eocene and Oligocene.
Diversity then declined rapidly in the Miocene leaving only six extant genera (Chara,
Lamprothamnium, Nitellopsis, Lychnothamnus, Nitella, and Tolypella).
It is unclear when the charophyte/land plant ancestor diverged or when the land
plants successfully colonized the land.  There are no undisputed fossils of charophyte
algae before the Silurian or of land plants before the Ordovician (Kenrick and Crane
1997).  Because primitive plants and most algae do not preserve well in the fossil record,
the possibility exists of an earlier, unrecorded history.  Consequently, information derived
from the fossil record combined with DNA sequence data are used here to estimate the
timing of these events.
Materials and Methods
Taxon sampling
To estimate divergence times in the Charophyta, the 40-taxon data set presented
in Chapter II was modified in the following ways, (1) several sequences determined using
older manual sequencing methods were re-sequenced with automated methods, (2)
43
several partial sequences were completed, (3) several sequences were replaced with those
from newly published sequences or sequences from the same species, (4) an additional
strain of Entransia fimbriata (Klebsormidiales) and of Chlorokybus atmosphyticus
(Chlorokybales) were added to increase sampling of these underrepresented groups, and
(5) seven charalean isolates were added to facilitate comparison with the fossil record.
Every effort was made to select charalean taxa that represent not only extant
morphological diversity but also molecular diversity within each genus.  Preliminary
phylogenetic analyses using unpublished rbcL sequence data from numerous species of
Chara and Lamprothamnium (R. M. McCourt pers. comm.) were used to determine that
Chara australis and C. connivens together adequately represent the molecular diversity
within Chara.  Lamprothamnium macropogon and L. heraldii were selected for
Lamprothamnium.  Similarly, the rbcL sequence data discussed in Chapter IV were used
to select Nitella hyalina and N. opaca to represent the genus Nitella.  DNA samples that
represent extant diversity across the genus Tolypella were not available; however,
Tolypella nidifica and Tolypella porteri were available and used as exemplars for one of
the two Sections of Tolypella (section Tolypella).  Because Nitellopsis and
Lychnothamnus each contain only a single extant species, two geographically disjunct
isolates were used for each of these species.  Isolates from Germany and China were used
for Nitellopsis obtusa, and isolates from Croatia and Australia were used for
Lychnothamnus barbatus.  Taxa were chosen to maximize the possibility of
reconstructing the deepest (i.e., oldest) branching point for these extant lineages and
minimize underestimating divergence times due to inadequate sampling of extant
lineages.
44
DNA isolation, PCR, and sequencing
DNA isolation, PCR, and sequencing of atpB, rbcL, nad5 and the small subunit of
the nrDNA (SSU) for ten taxa new to this study were performed following the protocols
described in Chapter II.  Attempts were made to determine nad5 gene sequences for
Spirogyra and Mesotaenium, both missing nad5 data in Chapter II.  These attempts failed
for Mesotaenium, but a partial sequence was determined for Spirogyra.  In summary, new
sequences were combined with the modified data set described above for a 50-taxon four-
gene data set.  A list of species, source, and GenBank accession numbers for new or
modified sequences from Table II-1 is shown in Table III-1.
45
TABLE III-1.  Lists of species, source, and GenBank accession numbers for specimens
that are either new to this study or modified (in bold face) from Table II-1.
StrainatpBrbcLnad5nrSSU
Land plants
 Psilotum nudumNC_003386NC_003386AJ012794X81963
 Dicksonia antarcticaU93829U05919AJ130745U18624.2
 Huperzia spp. U93819X98282AJ012795AF313567
 Anthoceros/PhaeocerosNC_004543NC_004543AJ000698U18491
Charales
 Chara australisX067AY823681AY823700AY823690AY823707
 Lamprothamnium heraldiiKGK0069AY823682AY823701AY823691AY823708
 Lychnothamnus barbatusAF408784AF097171AF408202AF408225.2
 Lychnothamnus barbatus3.25.95AY823683U27533AY823692AY823709
 Nitellopsis obtusaKGK0057eAY823684AY823702AY823693AY823710
 Nitella hyalinaKGK0059bAY823685AY823703AY823694AY823711
 Tolypella nidificaF138AY823686U27531AY823695AY823712
 Tolypella porteriX907AY823687AY823704AY823696AY823713
Coleochaetales
 Chaetosphaeridium globosumNC_004115NC_004115NC_004118AJ250110
Zygnematales
 Spirogyra maximaUTEX 2495AF408797L11057AY823697AF408236
Klebsormidiales
 Klebsormidium flaccidumAF408801.2L13478AF408217AF408240
 Klebsormidium subtilissimumAF408802AF408253.2AF408218AF408241.2
 Klebsormidium nitensAF408803.2AF408254AF408219AF408242
 Entransia fimbriataAF408804AF203496AF408220AF408243.2
 Entransia fimbriataMCAY823688AY823705AY823698AY823714
Chlorokybales
 Chlorokybus atmosphyticusSAG 34.98AY823689AY823706AY823699AY823715
Mesostigmatales
 Mesostigma virideAF408806AF408256AF408222.2AF408245
Outgroups
 Chlamydomonas reinhardtiiBK000554BK000554U03843M32703
 Pteromonas angulosaAB014038AJ001887ndAF395438
 Cyanophora paradoxaUTEX 555U30821U30821unpublishedAY823716
46
Phylogenetic analyses
Bayesian inference (BI) was carried out using MrBayes v3.0b4 (Huelsenbeck and
Ronquist, 2001).  MrBayes v3.0b4 differs from v2.0 in that the data can be partitioned
into subsets of the original data.  Implementing this option allows different models to be
specified for different data partitions.  In Chapter II a single model (GTR+I+?) was
applied to the entire four-gene data set.  A similar analysis was performed here as well as
an analysis that partitioned the data by gene.  GTR+I+? was used for each partition
(gene) and the parameters were individually estimated for each partition.  For each of
these analyses, two separate runs were carried out with four Markov chains, each starting
from a random tree.  The Markov chains were run for two million generations, sampling
every 100 generations, for a total of 20,000 samples per run.  The first 1,000 samples
from each run were discarded as burn-in (data points sampled before the chain reaches
stationarity), and the remaining 38,000 samples (19,000 from each run) were combined
into a single file and analyzed using the 'sumt' command in MrBayes.  Each independent
run with similar model settings found essentially identical tree topologies and posterior
probabilities (not shown), indicating that the sample number was sufficient to permit the
algorithm to converge on a global solution.
Maximum likelihood (ML) analyses were carried out using PAUP* v4.0b10
(Swofford, 2002).  Model selection procedures implemented in Modeltest v3.06 (Posada
and Crandall, 1998) identified the GTR+I+? model (general-time-reversible model
(Yang, 1994a) with invariable sites (Hasegawa et al., 1985) and gamma-distributed rates
(Yang, 1994b) for variable sites as the best fitting model from among 56 nested models.
ML parameters were optimized using the BI consensus tree topology.  With model
47
parameters estimated from the data, a heuristic search with three random taxon addition
sequences, TBR branch swapping, and steepest descent option active was performed.
Bootstrap analyses were conducted using 100 resampling replicates as implemented in
PAUP*.  For each bootstrap replicate, a heuristic search with three random taxon addition
sequences, NNI branch swapping, and steepest descent option active was performed.
Estimating divergence times
Divergence times within the Charophyta were estimated using a Bayesian relaxed
clock approach developed by Thorne and Kishino (2002) with the software DIVTIME 5b
kindly provided by Dr. Jeffrey Thorne.  This approach combines the advantages of
relaxing the molecular clock with a continuous autocorrelation of substitution rates over
evolutionary time and allows the simultaneous use of several calibration references.
Calibration references were derived from the literature or with the generous assistance of
Dr. Monique Feist (Table III-2).  All absolute ages were taken from the 1999 Geological
Time Scale of the Geological Society of America
(www.geosociety.org/science/timescale/timescl.pdf).
The dating procedure involved two steps.  First, the program ESTBRANCHES
was used to estimate branch lengths and the variance-covariance matrix for each gene
separately.  The tree topology generated by the BI and ML analyses was used as well as
an alternative topology that constrained Chara and Nitelleae to be monophyletic.  This
constrained topology, though not found by the BI or ML analyses, represents
relationships based on morphology and used extensively in the Charales literature (Wood,
1965).  The F84+? nucleotide substitution model is the most general model implemented
in ESTBRANCHES, and this model was used for all dating analyses.  Free parameters in
48
the F84+? model include base composition, transition-transversion rate parameter
(Ti/Tv), and four values that correspond to each discrete gamma rate category (?
1
-?
4
).
All parameters were estimated with PAUP* 4.0b10 and PAML 3.13 for individual gene
data sets and can be found in Table III-3.
In the second step of dating, Cyanophora paradoxa (the outgroup) was pruned
from the tree and the program DIVTIME was used to estimate the posterior and prior
estimates of divergence ages, their standard deviations (SD), and 95% credibility
intervals (Cred
95
).  For each analysis, the Markov chain was run for 2,200,000
generations.  The first 200,000 generations were treated as burn-in and not saved.  After
the burn-in cycle, the chain was sampled every 100 generations for a total of 20,000
samples.  The following prior distributions were set: 1 billion years (SD = 500 mya) for
the expected time between tip and root if there had been no constraint on node times, 0.5
(SD = 0.25) substitutions per site for rate at root node, 1.5 (SD = 1.5) for the parameter
?nu? that controls the amount of rate autocorrelation, and 10 billion years for the highest
number of time units between tip and root.  To insure that the Markov chain reached
stationarity, results from two independent runs with unique randomly selected starting
points were compared for each analysis.  Posterior and prior age estimates were
compared to evaluate whether the final age estimates were predominately a result of the
data or the priors.
49
Table III-2.  List of constrained lineages with geologic age, upper and lower fossil
calibration dates, and references used to estimate divergence times.
Constrained lineageGeologic AgeMYAReference
CharaConiacian-Turonian85-95M. Feist pers. comm.
LamprothamniumCampanian-Coniacian80-90M. Feist pers. comm.
Nitellopsis obtusaCalabrian0.5-0.7(Groves and Bullock-
Webster, 1924)
NitellaAlbian99-112(Horn af Rantzien, 1957)
Tolypella sect. TolypellaMaastrichtian65-71.3(Uliana and Musacchio,
1978)
50
TABLE III-3.  Estimated-parameter values under the F84 model of sequence evolution
as implemented in ESTBRANCHES.  These include base composition (%), transition-
transversion rate parameter (Ti/Tv), alpha (?), and four values that correspond to each
discrete gamma rate category (?
1
-?
4
).  Parameters were estimated with PAUP* 4.0b10 or
PAML 3.13.
% A% C% G% TTi/Tvalpha (?) ?
1
?
2
?
3
?
4
atpB0.375880.392330.105570.274982.747440.282750.004000.091160.565663.33917
rbcL0.296560.177220.117280.408941.550050.235180.001490.056210.469173.47313
nad50.253990.188030.144260.413721.368550.462250.026620.226260.790732.95608
SSU0.219440.246160.260480.273921.655700.230960.001340.053330.459573.48576
51
Results
Phylogenetic analyses
The data set used for phylogenetic analyses and estimating divergence times
excluded introns and unalignable regions for 5,199 characters.  A single highly variable
region of nad5 and three regions of the nuclear SSU gene, all of which corresponded to
putative loop regions, were excluded.  For the combined data set and for each gene
separately, the best fitting model of sequence evolution as determined with Modeltest
v3.06 was the general-time-reversible model with invariable sites and a gamma
distributed correction for rate variation among variable sites (GTR+I+?).  During
iterative parameter estimation procedures (Swofford et al., 1996), parameters converged
on identical values after two iterations and these values were fixed for all ML analyses.
Identical topologies were found by the BI and ML analyses of the combined four-
gene data set.  This topology, along with BI posterior probabilities using a single model
(PP), BI posterior probabilities using four models (PP
4
), and ML bootstrap values (BS), is
presented in Figure III-1.  Consistent with results presented in Chapter II, the Charales
were monophyletic (BS=100, PP=1.0, PP
4
=1.0) as were the land plants (BS=100, PP=1.0,
PP
4
=1.0).  The Charales were found as sister to the land plants with strong support
(BS=96, PP=1.0, PP
4
=1.0).  A monophyletic order Coleochaetales (BS=70, PP=1.0,
PP
4
=1.0) was found as sister to the Charales/land plant clade (BS=70, PP=1.0, PP
4
=1.0).
Other classically recognized orders were also found to be monophyletic: Zygnematales,
BS=100, PP=1.0, PP
4
=1.0; and Chlorokybales represented in this study by two strains,
BS=100, PP=1.0, PP
4
=1.0.   The placement of a second strain of Entransia fimbriata
52
FIGURE III-1.  Phylogenetic relationships for the Charophyta determined by Bayesian
inference (BI) and maximum likelihood (ML) analyses using the combined four-gene
data set rooted with Cyanophora.  BI posterior probabilities using a single model (PP),
and four models (PP
4
) are presented above branches, respectively.  ML bootstrap values
for 100 replicates are presented below branches.  All analyses resulted in an identical tree
topology.  For PP the likelihood of the best state drawn from the "cold" chain was -ln =
67847.95, for PP
4
 -ln = 67163.76, and the maximum likelihood tree score was -ln =
67819.00.  Branch lengths are Bayesian mean values from the PP
4
 analysis and are
proportional to the number of substitutions per site (scale bar, 0.05 substitutions/site).
Taxonomy is modified from Mattox and Stewart (1984).
53
54
sister to a UTEX strain of the same species (BS=100, PP=1.0, PP
4
=1.0) confirmed the
placement of this alga with the Klebsormidiales (BS=89, PP=1.0, PP
4
=1.0).  All analyses
strongly support the inclusion of Mesostigma within the Charophyta (BS=99, PP=1.0,
PP
4
=1.0).
Within the Charales, the two sections of Tolypella formed a strongly supported
monophyletic genus (BS=100, PP=1.0, PP
4
=1.0) sister to the rest of the family.  The tribe
Nitelleae was not recovered, with a monophyletic Nitella (BS=79, PP=1.0, PP
4
=0.98)
found sister to the tribe Chareae (BS=100, PP=1.0, PP
4
=1.0), rather than sister to
Tolypella as suggested by classical treatments (Wood, 1965).  The clade containing
Nitella and Chareae is the only relationship within the Charales not strongly supported by
any analytical method (BS=50, PP=0.75, PP
4
=0.73).  Within the Chareae two
monophyletic pairs were recovered: Nitellopsis/Lychnothamnus (BS=100, PP=1.0,
PP
4
=1.0) and Chara/Lamprothamnium (BS=100, PP=1.0, PP
4
=1.0).  Nitellopsis obtusa
(BS=100, PP=1.0, PP
4
=1.0) and Lychnothamnus barbatus (BS=100, PP=1.0, PP
4
=1.0) are
each monophyletic, while Chara is paraphyletic (BS=98, PP=1.0, PP
4
=1.0) with respect
to a monophyletic Lamprothamnium (BS=100, PP=1.0, PP
4
=1.0).
Comparisons of posterior probabilities between the Bayesian analyses using a
single model of sequence evolution and four models revealed few differences (values
above branches in Figure III-1).  In general, nodes that received PP=1.0 in the single-
model analysis received identical values for the four-model analysis (PP
4
=1.0).  Six
comparisons did differ, although five of these differed only slightly
([Embryo...Chlorokybales], PP=1.0, PP
4
=0.95; [Mesota...Zygnem], PP=1.0, PP
4
=0.97;
[Spirog...Zygnem], PP=0.62, PP
4
=0.59; Chareae + Nitella, PP=0.75, PP
4
=0.73; Nitella,
55
PP=1.0, PP
4
=0.98).  The sixth, and only substantial difference, was found for the vascular
plant clade (i.e., tracheophytes, PP=0.72, PP
4
=0.94).
Estimating divergence times
The Bayesian method of Thorne and Kishino (2002) was used to estimate
divergence times within the Charophyta.  Five calibration constraints were used
simultaneously with two tree topologies, the best BI-ML tree topology and the
constrained tree topology described above.  For each topology, a relaxed molecular clock
and a strict molecular clock were implemented.  Comparisons of the posterior and prior
divergence ages for each run showed that the 95% credibility intervals differ for most
nodes, with narrower credibility intervals for posterior ages indicating that much of the
information regarding divergence times can be attributed to the DNA sequence data
rather than the priors (Table III-4a, Table III-4b).  The constrained tree yielded generally
older age estimates and slightly larger 95% credibility intervals than those generated
using the BI-ML tree.  Results generated under a strict molecular clock were markedly
older than the relaxed clock analyses.
56
Table III-4.  Estimated divergence times within the Charophyta.  Five calibration points
were used to estimate absolute divergence ages (Table III-2).  Values correspond to the
posterior and prior divergence age?s ? one standard deviation.  Values were calculated
according to the Bayesian relaxed molecular clock approach and according to a strict
molecular clock.  The 95% credibility intervals (Cred
95
) for posterior and prior
divergence ages are given in parentheses.  Two slightly different topologies were
examined: (a) the BI-ML topology (Figure III-1), and (b) monophyletic Chara and
monophyletic Nitelleae, respectively.  Because valid names are not available for many of
the deeper relationships (clades) within the Charophyta, names were created and are
defined in Appendix I.  Data are presented as million years ago (mya).
57
Table III-4a
Relaxed ClockStrict Clock
Clade PosteriorPriorPosteriorPrior
Volvox...Chlam213.02 ? 62.01
(114.30-354.92)
119.40 ? 119.56
(3.60-439.44)
439.19 ? 61.70
(327.00-569.32)
117.48 ? 116.94
(2.77-428.89)
Volvox...Paulsc315.11 ? 79.93
(183.57-496.09)
240.11 ? 171.58
(32.55-675.07)
620.70 ? 77.74
(478.31-785.01)
235.30 ? 165.20
(30.53-659.85)
Volvox...Pterom515.95 ? 105.47
(336.79-747.80)
361.44 ? 209.46
(85.08-887.77)
869.57 ? 101.82
(684.90-1087.18)
353.50 ? 203.57
(82.58-867.57)
Chlorophyta928.56 ? 150.70
(668.57-1261.24)
479.71 ? 238.62
(157.72-1082.94)
1695.84 ? 186.33
(1359.06-2092.64)
471.71 ? 236.08
(155.62-1062.48)
Mesostigma100.16 ? 58.64
(17.94-240.90)
271.42 ? 208.82
(12.70-787.48)
76.27 ? 16.17
(46.48-109.79)
269.77 ? 209.31
(11.94-799.79)
Chlorokybus59.31 ? 36.70
(10.77-151.52)
243.90 ? 186.35
(11.15-708.27)
21.11 ? 9.70
(3.56-41.58)
241.63 ? 186.41
(10.48-709.19)
Entransia4.33 ? 5.63
(0.12-19.98)
163.81 ? 139.16
(6.77-518.34)
6.08 ? 4.39
(0.28-16.55)
161.48 ? 136.22
(6.55-513.09)
Klenit...Klesub60.73 ? 21.76
(29.35-112.77)
105.87 ? 102.55
(2.85-381.57)
178.20 ? 29.78
(123.42-240.52)
107.77 ? 103.59
(3.36-381.07)
Klenit...Klefla211.01 ? 51.00
(128.46-324.89)
215.52 ? 142.36
(31.72-581.05)
551.43 ? 80.59
(407.53-720.64)
214.95 ? 143.13
(33.67-578.86)
Klebsormidiales752.30 ? 119.74
(545.25-1014.28)
324.61 ? 172.50
(93.59-761.78)
1902.78 ? 205.64
(1535.25-2339.63)
322.28 ? 169.42
(92.14-749.34)
Mesota...Mougeo426.80 ? 80.03
(289.10-600.73)
92.99 ? 88.11
(2.49-328.98)
1017.55 ? 122.78
(797.97-1281.83)
92.88 ? 89.13
(2.69-327.13)
Spirog...Zygnem568.25 ? 94.70
(403.96-773.07)
94.09 ? 91.80
(2.47-342.96)
1143.32 ? 126.63
(915.68-1412.58)
93.23 ? 90.43
(2.59-332.03)
Mesota...Zygnem625.86 ? 100.42
(451.79-844.19)
186.62 ? 124.95
(27.12-502.25)
1488.04 ? 152.65
(1219.09-1810.69)
186.54 ? 123.98
(27.98-500.38)
Cosmoc...Onycho351.22 ? 71.51
(229.29-506.36)
93.31 ? 89.01
(2.71-326.15)
601.24 ? 77.45
(460.97-763.71)
93.11 ? 88.79
(2.53-325.12)
Cosmoc...Gonato549.60 ? 93.33
(390.39-754.97)
188.54 ? 123.24
(28.33-498.16)
1171.18 ? 131.09
(937.95-1451.51)
187.56 ? 124.86
(26.75-503.43)
Zygnematales706.32 ? 110.28
(515.32-946.80)
282.21 ? 149.95
(82.51-650.91)
1676.27 ? 165.70
(1383.90-2034.21)
280.60 ? 147.78
(78.53-653.28)
Chaetosphaeridium
globosum
53.28 ? 23.06
(22.98-110.49)
80.85 ? 76.57
(2.63-280.50)
76.95 ? 16.76
(45.55-111.21)
79.62 ? 75.23
(2.35-272.88)
Chaetosphaeridium64.32 ? 26.89
(28.71-131.09)
162.57 ? 105.70
(25.01-428.83)
112.33 ? 19.70
(75.93-153.28)
159.78 ? 103.95
(24.56-417.38)
Cirreg...Csiemi220.35 ? 54.74
(130.39-342.61)
80.81 ? 76.22
(2.45-278.79)
348.3 ? 48.83
(260.23-451.36)
80.32 ? 76.59
(2.34-281.56)
Corbic...Csolut303.43 ? 64.11
(195.90-444.89)
81.34 ? 77.63
(2.42-285.45)
515.67 ? 64.39
(399.63-649.00)
80.42 ? 75.94
(2.43-278.16)
58
Relaxed ClockStrict Clock
Clade PosteriorPriorPosteriorPrior
Coleochaete475.40 ? 81.09
(336.95-653.94)
161.74 ? 105.95
(25.70-433.89)
840.27 ? 93.78
(671.41-1040.54)
160.10 ? 103.69
(24.50-421.76)
Coleochaetales668.50 ? 102.43
(491.83-891.22)
243.98 ? 126.57
(73.44-569.36)
1444.33 ? 151.59
(1173.86-1768.24)
239.94 ? 123.13
(73.47-553.28)
Tolypella sect. Tolypella67.32 ? 1.70
(65.08-70.92)
68.13 ? 1.81
(65.16-71.14)
68.14 ? 1.81
(65.17-71.14)
68.13 ? 1.82
(65.16-71.15)
Tolypella189.43 ? 24.01
(147.27-241.59)
140.08 ? 62.53
(70.80-307.03)
237.98 ? 37.06
(170.22-316.38)
139.57 ? 63.21
(70.73-303.53)
Nitella109.62 ? 2.24
(103.59-111.94)
105.30 ? 3.72
(99.29-111.61)
107.5 ? 3.43
(99.95-111.85)
105.35 ? 3.76
(99.30-111.67)
Nitellopsis0.60 ? 0.06
(0.51-0.70)
0.60 ? 0.06
(0.51-0.69)
0.60 ? 0.06
(0.51-0.69)
0.60 ? 0.06
(0.50-0.69)
Lychnothamnus3.10 ? 2.46
(0.13-9.24)
31.06 ? 29.54
(0.57-103.97)
5.07 ? 3.78
(0.19-14.10)
30.90 ? 29.25
(0.54-103.24)
Lychno...Nitops70.77 ? 14.06
(46.30-101.00)
61.90 ? 40.20
(3.75-148.92)
101.43 ? 20.54
(62.25-143.00)
61.75 ? 40.24
(3.63-148.20)
Lamprothamnium81.37 ? 1.31
(80.04-84.87)
83.52 ? 2.53
(80.13-89.09)
81.27 ? 1.24
(80.03-84.57)
83.51 ? 2.54
(80.13-89.11)
Lampro...Cconni88.24 ? 3.36
(81.66-93.86)
87.40 ? 3.16
(81.56-93.35)
87.05 ? 3.45
(81.10-93.52)
87.38 ? 3.15
(81.57-93.26)
Lampro...Caustr92.40 ? 2.18
(86.97-94.92)
91.30 ? 2.59
(85.77-94.84)
91.92 ? 2.43
(86.22-94.90)
91.24 ? 2.60
(85.80-94.85)
Chareae155.47 ? 16.32
(126.87-191.16)
122.72 ? 33.49
(91.09-214.21)
208.81 ? 29.74
(153.72-270.69)
122.80 ? 34.03
(90.93-212.69)
Chareae+Nitella204.36 ? 18.14
(172.92-243.86)
163.50 ? 54.81
(106.68-309.05)
311.65 ? 37.30
(243.91-389.13)
163.50 ? 56.62
(106.68-316.76)
Charales247.75 ? 25.98
(202.01-303.96)
212.23 ? 81.62
(118.09-424.13)
378.63 ? 47.83
(291.77-480.56)
211.64 ? 82.23
(118.27-430.33)
Moniliformopses263.36 ? 48.63
(180.68-370.86)
37.99 ? 39.40
(0.96-142.32)
967.33 ? 113.16
(763.38-1207.52)
37.98 ? 38.84
(0.89-142.31)
Seed plants230.88 ? 43.85
(156.78-328.10)
38.57 ? 39.68
(0.95-143.78)
969.42 ? 114.24
(766.12-1210.23)
37.97 ? 39.82
(1.02-141.57)
Euphyllophytes341.44 ? 58.59
(242.05-469.67)
76.45 ? 56.18
(9.09-220.62)
1166.61 ? 113.50
(965.19-1407.69)
76.13 ? 56.39
(9.92-221.47)
Tracheophytes389.92 ? 64.71
(279.19-528.94)
114.67 ? 69.60
(23.94-292.79)
1202.47 ? 114.44
(1000.77-1445.84)
114.25 ? 70.26
(25.54-293.61)
Trache...Sphagu418.00 ? 68.07
(301.55-564.80)
152.95 ? 81.48
(45.29-361.21)
1234.31 ? 116.40
(1028.54-1480.77)
152.64 ? 81.98
(46.65-360.14)
Trache...Anthos460.12 ? 72.56
(334.69-615.96)
191.15 ? 91.74
(70.44-423.51)
1288.33 ? 121.29
(1071.17-1546.51)
190.62 ? 93.18
(71.00-430.42)
(Land plants) Embryophytes497.78 ? 75.66
(366.89-661.00)
229.45 ? 101.6
(99.71-485.26)
1359.89 ? 130.51
(1128.98-1638.14)
228.40 ? 102.86
(100.43-497.70)
Embryo...Charales674.15 ? 99.69
(501.06-889.85)
267.91 ? 111.02
(131.57-551.65)
1747.99 ? 170.33
(1443.91-2112.97)
266.21 ? 112.27
(133.82-560.67)
59
Relaxed ClockStrict Clock
Clade PosteriorPriorPosteriorPrior
Embryo...Coleochaetales723.89 ? 109.16
(535.32-962.22)
324.43 ? 143.48
(147.83-692.54)
1858.65 ? 176.89
(1544.34-2239.97)
320.77 ? 139.65
(152.46-687.46)
Embryo...Zygnematales775.87 ? 118.27
(571.03-1035.08)
378.10 ? 169.40
(166.40-802.05)
2013.19 ? 188.95
(1680.02-2420.64)
375.61 ? 166.28
(171.08-806.23)
Embryo...Klebsormidiales826.92 ? 127.94
(605.99-1107.58)
433.15 ? 194.21
(185.83-921.75)
2107.04 ? 198.91
(1755.45-2532.86)
430.02 ? 192.05
(188.46-930.00)
Embryo...Chlorokybus928.64 ? 143.71
(681.71-1247.18)
488.55 ? 218.32
(204.98-1043.64)
2142.42 ? 202.22
(1788.33-2572.98)
484.36 ? 217.11
(208.02-1045.55)
Charophyta1003.9 ? 153.82
(740.52-1344.59)
543.07 ? 242.82
(226.42-1162.09)
2218.10 ? 211.34
(1844.61-2667.71)
538.18 ? 240.31
(226.84-1150.06)
Charophyta...Chlorophyta1144.6 ? 173.72
(843.90-1526.79)
598.26 ? 266.44
(245.97-1273.82)
2526.63 ? 251.13
(2078.54-3059.72)
592.82 ? 264.89
(248.93-1262.16)
60
Table III-4b
Relaxed ClockStrict Clock
Clade PosteriorPriorPosteriorPrior
Volvox...Chlam231.72 ? 65.44
(125.34-380.30)
146.79 ? 144.36
(3.99-535.55)
447.71 ? 62.84
(332.56-580.49)
150.93 ? 149.14
(4.10-553.14)
Volvox...Paulsc344.23 ? 84.81
(203.51-533.71)
298.28 ? 203.09
(40.07-804.36)
636.16 ? 79.94
(492.04-805.34)
302.60 ? 212.48
(39.47-857.53)
Volvox...Pterom550.65 ? 111.42
(363.24-797.22)
448.41 ? 246.84
(106.92-1043.84)
887.41 ? 103.94
(700.83-1106.44)
455.85 ? 264.13
(107.57-1115.50)
Chlorophyta982.66 ? 160.16
(714.15-1344.78)
597.13 ? 278.60
(201.95-1279.52)
1733.91 ? 188.14
(1399.71-2133.98)
607.54 ? 305.87
(193.47-1369.31)
Mesostigma113.62 ? 63.00
(23-267.40)
339.75 ? 254.32
(14.39-960.65)
75.97 ? 16.10
(45.98-109.69)
344.96 ? 268.73
(13.72-1027.25)
Chlorokybus63.03 ? 39.43
(11.57-163.91)
311.48 ? 236.64
(14.39-891.86)
20.64 ? 9.62
(3.26-40.74)
316.60 ? 244.46
(13.02-929.33)
Entransia4.65 ? 6.00
(0.12-21.30)
212.94 ? 176.54
(6.85-658.28)
5.88 ? 4.23
(0.25-15.77)
211.32 ? 180.48
(7.54-673.25)
Klenit...Klesub64.81 ? 22.66
(32.04-118.92)
138.78 ? 130.80
(4.47-479.12)
180.65 ? 30.04
(125.47-243.50)
140.64 ? 136.22
(3.82-499.06)
Klenit...Klefla225.38 ? 53.15
(139.19-345.47)
279.95 ? 179.76
(43.08-724.60)
562.91 ? 80.68
(417.09-731.59)
280.79 ? 189.64
(40.58-764.91)
Klebsormidiales799.46 ? 127.12
(586.46-1084.36)
420.64 ? 210.51
(125.75-931.20)
1937.27 ? 206.96
(1564.10-2373.02)
423.01 ? 228.20
(114.14-997.00)
Mesota...Mougeo452.87 ? 85.07
(308.12-639.92)
124.06 ? 115.92
(3.49-425.94)
1038.89 ? 124.74
(817.33-1300.68)
125.36 ? 123.01
(3.41-455.04)
Spirog...Zygnem599.29 ? 100.23
(432.06-824.43)
121.93 ? 112.26
(3.35-413.06)
1147.74 ? 128.8
(919.01-1420.50)
126.70 ? 123.73
(3.62-453.69)
Mesota...Zygnem664.14 ? 106.71
(487.07-903.63)
243.91 ? 153.82
(35.20-618.08)
1516.33 ? 154.07
(1246.19-1848.83)
251.09 ? 170.22
(36.54-685.78)
Cosmoc...Onycho376.45 ? 75.94
(249.52-545.48)
123.91 ? 116.30
(3.32-435.61)
617.10 ? 79.73
(475.52-787.33)
123.77 ? 120.50
(3.51-441.32)
Cosmoc...Gonato583.16 ? 98.17
(419.00-800.06)
246.15 ? 159.04
(37.09-642.01)
1200.71 ? 135.53
(961.45-1491.24)
248.41 ? 167.77
(36.24-676.11)
Zygnematales748.81 ? 117.03
(554.07-1009.38)
366.91 ? 183.81
(104.42-815.48)
1709.50 ? 167.88
(1418.97-2071.39)
374.28 ? 203.40
(104.36-889.98)
Cheat. globosum55.87 ? 24.44
(24.43-118.38)
108.23 ? 102.81
(3.30-375.61)
78.02 ? 16.64
(46.65-112.69)
107.86 ? 105.90
(3.08-386.06)
Chaetosphaeridium67.16 ? 28.46
(29.95-139.01)
215.47 ? 139.13
(32.09-556.89)
113.36 ? 19.56
(77.78-154.08)
217.16 ? 147.37
(33.49-589.48)
Cirreg...Csiemi234.90 ? 58.42
(139.72-366.51)
107.73 ? 103.13
(3.11-376.14)
352.88 ? 48.68
(264.46-453.91)
107.47 ? 104.68
(2.71-387.31)
Corbic...Csolut323.31 ? 67.89
(210.23-475.11)
108.65 ? 103.15
(3.33-380.01)
522.09 ? 65.07
(403.80-660.61)
108.71 ? 106.22
(3.08-391.65)
61
Relaxed ClockStrict Clock
Clade PosteriorPriorPosteriorPrior
Coleochaete505.21 ? 85.89
(360.24-696.68)
216.06 ? 140.90
(33.76-562.37)
858.06 ? 95.01
(687.08-1061.63)
216.18 ? 145.33
(32.66-586.04)
Coleochaetales710.49 ? 108.64
(531.17-954.08)
322.23 ? 166.12
(93.89-730.32)
1485.50 ? 154.64
(1211.38-1817.19)
325.08 ? 177.16
(95.03-774.41)
Tolypella sect. Tolypella67.17 ? 1.66
(65.07-70.85)
68.13 ? 1.83
(65.15-71.14)
68.08 ? 1.81
(65.15-71.12)
68.11 ? 1.82
(65.15-71.13)
Tolypella166.01 ? 20.55
(129.92-210.29)
130.36 ? 57.37
(70.45-284.25)
210.95 ? 34.20
(147.37-280.66)
130.75 ? 60.87
(70.43-293.50)
Nitella109.72 ? 2.16
(103.73-111.94)
105.39 ? 3.71
(99.35-111.64)
107.46 ? 3.43
(99.88-111.85)
105.42 ? 3.75
(99.33-111.67)
Nitelleae215.37 ? 20.15
(180.85-259.74)
192.22 ? 78.35
(108.65-402.69)
312.57 ? 38.99
(240.98-394.14)
192.62 ? 83.24
(108.11-418.44)
Nitellopsis0.60 ? 0.06
(0.51-0.69)
0.60 ? 0.06
(0.51-0.69)
0.60 ? 0.06
(0.50-0.70)
0.60 ? 0.06
(0.51-0.70)
Lychnothamnus3.84 ? 3.12
(0.15-11.71)
46.90 ? 47.93
(0.81-170.58)
5.15 ? 3.78
(0.21-14.16)
47.06 ? 48.83
(0.77-173.50)
Lychno...Nitops91.53 ? 17.90
(60.02-130.26)
95.04 ? 69.46
(4.98-265.79)
113.21 ? 20.97
(74.11-156.44)
94.38 ? 70.68
(4.53-266.63)
Lamprothamnium81.99 ? 1.87
(80.05-87.13)
84.96 ? 2.88
(80.26-89.72)
81.64 ? 1.61
(80.04-86.08)
84.97 ? 2.89
(80.25-89.75)
Chara90.97 ? 2.76
(85.48-94.85)
89.82 ? 2.85
(85.22-94.72)
90.80 ? 2.82
(85.39-94.85)
89.82 ? 2.89
(85.24-94.75)
Chara...Lampro122.51 ? 9.76
(104.71-142.92)
131.65 ? 46.78
(89.89-259.85)
140.14 ? 16.47
(109.26-174.23)
131.71 ? 46.63
(89.79-257.96)
Chareae187.75 ? 20.43
(151.6-231.06)
188.44 ? 77.56
(101.10-395.86)
250.00 ? 32.42
(190.13-317.86)
189.06 ? 81.46
(101.67-399.79)
Charales277.98 ? 28.21
(229.23-340.26)
263.44 ? 106.86
(132.96-543.74)
404.85 ? 49.97
(312.85-509.24)
266.69 ? 117.10
(131.02-573.71)
Moniliformopses282.14 ? 51.17
(197.51-394.44)
51.01 ? 51.50
(1.40-186.19)
986.33 ? 115.27
(780.00-1230.55)
52.16 ? 55.56
(1.33-201.19)
Seed plants245.80 ? 46.06
(168.77-348.20)
51.73 ? 53.82
(1.26-193.23)
984.75 ? 114.92
(777.78-1227.84)
52.27 ? 55.34
(1.25-198.98)
Euphyllophytes362.74 ? 61.63
(259.73-501.37)
102.54 ? 75.80
(12.59-295.54)
1183.88 ? 115.14
(979.65-1431.00)
104.40 ? 81.08
(12.32-318.93)
Tracheophytes414.89 ? 68.11
(301.19-566.08)
154.11 ? 94.06
(31.80-385.71)
1219.48 ? 115.95
(1013.14-1469.56)
157.21 ? 103.56
(31.92-429.30)
Trache...Sphagu445.48 ? 71.84
(325.24-606.03)
206.32 ? 111.06
(58.87-476.91)
1251.97 ? 118.23
(1042.48-1504.38)
210.12 ? 122.34
(58.52-526.73)
Trache...Anthos490.37 ? 76.43
(361.57-660.84)
258.34 ? 125.38
(89.88-572.5)
1306.52 ? 122.75
(1089.14-1569.73)
262.79 ? 140.10
(89.83-624.69)
(Land plants)
Embryophytes
526.31 ? 79.34
(391.98-703.50)
310.19 ? 139.23
(126.08-654.81)
1380.23 ? 132.66
(1146.58-1670.90)
314.59 ? 156.00
(124.53-715.48)
Embryo...Charales716.74 ? 105.53
(539.02-952.27)
361.91 ? 152.65
(164.37-741.66)
1800.18 ? 174.54
(1491.50-2176.28)
366.93 ? 171.77
(160.05-809.29)
62
Relaxed ClockStrict Clock
Clade PosteriorPriorPosteriorPrior
Embryo...Coleochaetales771.24 ? 116.54
(576.67-1032.21)
427.20 ? 182.00
(188.92-879.80)
1910.86 ? 181.05
(1594.83-2300.75)
432.84 ? 201.49
(184.59-935.62)
Embryo...Zygnematales825.70 ? 126.28
(614.87-1109.49)
491.09 ? 206.54
(214.43-1010.56)
2056.55 ? 191.40
(1719.54-2472.41)
498.73 ? 230.88
(206.74-1083.35)
Embryo...Klebsormidiales878.10 ? 136.24
(649.92-1182.80)
555.07 ? 232.47
(240.19-1140.08)
2149.41 ? 200.82
(1794.36-2582.95)
563.86 ? 258.11
(231.94-1203.94)
Embryo...Chlorokybus987.17 ? 153.09
(730.23-1328.51)
619.15 ? 257.48
(265.41-1260.62)
2185.15 ? 204.48
(1823.74-2631.15)
628.84 ? 286.71
(254.93-1350.64)
Charophyta1063.34 ? 164.54
(787.83-1433.56)
682.75 ? 280.49
(291.77-1372.54)
2260.30 ? 213.64
(1883.78-2719.74)
693.89 ? 314.13
(280.96-1471.36)
Charophyta...Chlorophyta1206.35 ? 184.95
(896.82-1621.47)
746.91 ? 305.62
(317.72-1494.33)
2582.46 ? 254.38
(2133.17-3128.13)
758.97 ? 341.06
(306.80-1607.64)
63
The individual a priori calibration constraints ranged in age from the Upper Early
Cretaceous for Nitella, the Middle Late Cretaceous for Chara and Lamprothamnium, the
uppermost Late Cretaceous for Tolypella section Tolypella, to the Early Quaternary
(Pleistocene) for Nitellopsis obtusa (Table III-2).  The Bayesian relaxed clock approach
estimated that the Charophyta and Chlorophyta split occurred 1144.6 ? 173.72 MYA
during the Middle Proterozoic, the lower bound of the prior 95% credibility interval.  The
lineage that gave rise to Mesostigmatales split shortly thereafter (1003.9 ? 153.82 MYA)
followed by the Chlorokybales lineage (928.64 ? 143.71 MYA) from the remaining
Charophyta.  The Late Proterozoic represents a period of relatively rapid cladogenesis for
the Charophyta resulting in the Klebsormidiales (752.3 ? 119.74 MYA), Zygnematales
(706.32  ? 110.28 MYA), Coleochaetales (668.50 ? 102.43 MYA), and the divergence of
the Charales/land plant common ancestor (674.10 ? 99.96 MYA).  Modern land plants
arose in the Cambrian (497.78 ? 75.66 MYA) and modern Characeae diverged at the
Paleozoic/Mesozoic boundary (247.75 ? 25.98 MYA).  These results are presented in tree
form in Figure III-2.
64
Figure-III-2.  BI-ML tree topology drawn with branch lengths proportional to absolute
divergence times inferred from the Bayesian relaxed molecular clock approach.  Red
vertical bars represent upper and lower limits of fossil dates on constrained nodes, blue
vertical bars show posterior 95% credibility intervals (Cred
95
) for non-constrained nodes.
The geologic time scale is shown as follows: Cenozoic, blue; Mesozoic, red; and
Paleozoic, green.  Shades of each color represent the Periods within those Eras.  The Late
and Middle Proterozoic are shown in shades of yellow.
65
66
The BI-ML tree topology was used to explore the relative contribution of each
calibration constraint to the result using all calibration constraints simultaneously.  These
comparisons are presented in Figure III-3.  Taken together, the 95% credibility intervals
using a single calibration constraint overlap to form a continuous distribution that covers
a relatively large time interval.  These intervals were substantially reduced in the
combined analysis.   The 95% credibility intervals were generally wider for the single-
calibration analyses with the exception of Nitella, which were generally narrower than
other single-calibration analyses and the combined analysis.   The 95% credibility
intervals for Lamprothamnium were especially wide and were consistently found outside
of the combined 95% credibility intervals.
67
Figure III-3.  Comparison of the posterior 95% credible intervals.  Using the BI-ML
topology separate analyses were performed for the five calibration constraints.  The 95%
credibility intervals for these analyses (black bars) are shown along with results using all
constraints simultaneously (grey bars).  Individual results for each constraint are
presented as follows: Lamprothamnium, Tolypella, [Lampro...Caustr], Nitellopsis, and
Nitella.  An asterisk (*) denoted constrained clades.  Clades along the X-axis are in
identical order as Table III-4a and the Y-axis is the time scale in billion years (BYA).
68
69
Discussion
Phylogenetic analyses
As in the analyses presented here, Chapter II included a range of charophycean
algal diversity, but used data from fewer taxa particularly in the Charales.  The higher-
lever relationships shown in Chapter II (Figure II-2) were similar to those reported here
(Figure III-1), with Charales sister to land plants and Coleochaetales sister to the
Charales/land plant clade.  The clades [Embryo...Zygnematales], Klebsormidiales, and
[Mesota...Zygnem] showed increased bootstrap support which is unsurprising as new
data from an additional strain of Chlorokybus atmosphyticus and Entransia fimbriata and
nad5 data for Spirogyra maxima were added to this data set.  Support within the
Chlorophyta also seemed to be improved by sampling sequences from genes in the same
species (Chapter III) rather than sequences sampled from different species of the same
genus (Chapter II).  This result is, on the one hand, reassuring in that support values
increased, but on the other hand, stresses the advantage of using sequences determined
from the same species (if not the same individual) over concatenated genes from putative
close relatives.
The additional representatives of the Charales had little impact on support for the
Charales/land plant clade (the analyses in Chapter II and here show strong support),
although, relationships within the Charales were interesting.  The multi-gene analyses
produced relationships differing in certain features from that proposed by Wood (1965),
yet there were some shared features.  Monophyly of the Charales was firmly established
by these data with further support to be found in vegetative and reproductive morphology
70
(Wood, 1965) as well as the fossil record (Grambast, 1974).  Monophyly of the tribe
Chareae, united by five coronal cells, was also strongly supported, but monophyly of
Nitelleae (Tolypella+Nitella) was not.  A similar result was found using rbcL sequence
data (McCourt et al., 1999; McCourt et al., 1996a).  All members of the Nitelleae possess
ten coronal cells and this character has been interpreted as a synapomorphy for the tribe.
Although not strongly supported, the possibility exists that ten coronal cells represent an
ancient ancestral character state rather than a character state derived in Nitelleae.  The
fossil record offers little resolution to this question because coronal cells are rarely
preserved (Feist and Grambast-Fessard, 1991; Grambast, 1974; Tappan, 1980).
Within the Chareae, three of the four genera were monophyletic, Nitellopsis,
Lychnothamnus, and Lamprothamnium.  Both Nitellopsis and Lychnothamnus contain
one species and are relatively rare (Wood, 1965).  Lamprothamnium contains several
species, and is cosmopolitan, but species in this genus generally are restricted to brackish
environments (Corillion, 1957; Wood, 1965).  Chara, represented by two species in this
study, was paraphyletic with respect to Lamprothamnium, a result also found using
nuclear SSU gene sequence data alone (Meiers et al., 1999).  Characters distinguishing
Lamprothamnium from Chara include elongate stipulodes found opposite branchlets,
stipulodes sometimes above branchlets, incurved branchlets, upper whorls contracted into
?fox tails? resulting from reduced internode cells, and oogonia generally positioned below
antheridia.  In Chara, stipulodes are alternate and never found above branchlets, and
oogonia are always found above antheridia (when conjoined).  Lamprothamnium is
entirely ecorticate as are members of Chara section Charopsis.  Both male and female
gametangia originate from the same peripheral cell in Lamprothamnium and Chara while
71
they initiate from different peripheral cells in Lychnothamnus.  The dioecious state of
Nitellopsis prevents examination of gametangia orientation and ontogeny in this genus.
The taxonomic status of Lamprothamnium is unclear, and as suggested by Wood (1965),
Lamprothamnium could well represent a third subgenus of Chara.  Nuclear SSU gene
sequence data placed Lamprothamnium sister to a clade including Charopsis (ecorticate)
and Agardhia (axial cortication), though this result was sensitive to analytical method
(Meiers et al., 1999).  Phylogenetic analyses using rbcL (McCourt et al., 1999) or rbcL
and matK (Sanders et al., 2003) placed Lamprothamnium sister to Chara; however,
representatives of sections Charopsis or Agardhia were not included in either study.
Results presented here are limited to only two Chara species, Chara connivens (section
Grovesia) and Chara australis (section Charopsis).  Lamprothamnium was found sister to
Chara connivens, not sister to Chara australis, presenting yet another hypothesis.  It is
clear that further morphological and molecular data will be required to resolve the
phylogenetic placement of Lamprothamnium.
?Simple? and ?complex? models
In Chapter II, a Bayesian analysis using a general model of DNA substitution
(GTR+I+?) was applied to the entire four-gene data set.  A similar analysis was
performed here in addition to an analysis that partitioned the data by gene, in which
GTR+I+? parameters were estimated separately for each partition.  Comparisons of
posterior probabilities between these analyses (Figure III-1) revealed several differences,
all of which were minor with the exception of one.  Several possibilities exist that could
explain this result.  On the one hand, the differences may represent a more realistic
description of these data, i.e., that the topology is not entirely stable.  Many millions of
72
years have pasted since the ancestor of the Charophyta diverged, and it is unlikely that
any single model of DNA evolution can accurately describe these data without error.
Likelihood methods, however, are generally robust to model violation (Felsenstein, 1981)
and the limited number of differences between these analyses may be an example of this.
The relatively large difference detected for the vascular plant clade (tracheophytes) is an
especially noteworthy result (PP = 0.72, PP
4
 = 0.94; Figure III-1).  It is possible that some
feature of a particular gene in this clade is evolving differently from the same gene in
other lineages (e.g., long-branch-attraction, base compositional bias).  If this is the case,
parameters estimated across the entire dataset may not adequately describe the vascular
plant clade data, leading to violation of the model.  On the other hand, random error
incurred by adding parameters must also be considered.  Complex models are more
sensitive to random error than simple models because more parameters are estimated
from the same amount of data.  The nodes that exhibit relatively small amounts of
variation could be an example of this phenomenon.  The vascular plant clade offers an
interesting region of this tree to further study the underlying cause of this difference.  The
small number of differences between posterior probabilities across the entire tree
suggests that both models might be performing similarly, and additional parameters may
be useful in detecting regions of the tree requiring further study.
The fossil record of Characeae genera
Minimum fossil dates for five extant lineages of the Characeae were determined
from the literature or with the assistance of Dr. Monique Feist (Montpellier) (Table III-
X).  Available field or culture collections of extant forms allowed fossil record
comparisons of Chara, Lamprothamnium, and Nitellopsis obtusa for Chareae, and Nitella
73
and Tolypella section Tolypella for Nitelleae.  Fossil calibration dates for Chara and
Lamprothamnium (both Late Cretaceous) were provided by Dr. Monique Feist.  The
dioecious Nitellopsis obtusa is the only extant species of this genus.  It is relatively rare
and typically reproduces by specialized starch-rich bulbils.  Consequently little was
known of Nitellopsis oospores until Krassavina (1971) found oospores in the gut contents
of ducks and from this was able to establish a connection of Nitellopsis obtusa with the
fossil species Tectochara diluviana.  The genus Tectochara (now considered a synonym
of Nitellopsis) is known from the Paleocene to Quaternary, although Nitellopsis obtusa
(Tectochara diluviana) has a more restricted fossil history (lowermost Quaternary from
the Cromer Forest bed) (Groves, 1933; Groves and Bullock-Webster, 1924).
Nitella is one of the oldest and most species rich extant genera in the Characeae;
however, Nitella fossils are relatively rare.  Unlike other extant genera, Nitella has small
oospores, which are relatively small, laterally compressed, and have spiral jacket-cells
which do not calcify, leading to their paucity in the fossil record.  Nevertheless, there are
several reports of Quaternary and Pre-Quaternary gyrogonites assigned to Nitella [see
Horn af Rantzien (1957; 1959) and references therein].  The gyrogonites? sizes, shapes,
and lack of calcification were the main characters used to ally the Quaternary specimens
with Nitella.  The Pre-Quaternary gyrogonites have been judged as likely not belonging
to Nitella since they show no characters unique to Nitella, and most notably are not
laterally compressed (Groves, 1933; Horn af Rantzien, 1951; Horn af Rantzien, 1959).  A
remarkable exception to this trend was first reported by Vishnu-Mittre (1952) from the
Rajmahal Basin, Bihar, India and formally described by Horn af Rantzien (1957).  The
Rajmahal gyrogonites are relatively small and laterally compressed but show well-
74
preserved oospore cell wall ornamentation, strikingly similar to many extant members of
Nitella.  In the absence of coronal cells and vegetative thalli that would unequivocally
identify these fossils as Nitella, Horn af Rantzien (1957) was conservative and placed
these fossils in a new organ genus Nitellites.  The geologic age for the Rajmahal series
has been difficult to determine with confidence and this is reflected in the scope of ages
proposed for this region, from Triassic to early Cretaceous (summarized in Horn af
Rantzien, 1957).  This period of India's geologic history is complicated by the onset of
volcanism that produced the Deccan traps (large flood basalts) and covered or wiped out
much of the sedimentary record.  Detailed stratigraphic mapping (Sen Gupta, 1988)
combined with radiometric dating (Tiwari and Tripathi, 1993) and megaflora evidence
(Banerji, 2000) now firmly establishes an Early Cretaceous (Albian) age for the Nitellites
fossils.
The basal plate subtending the oospore is rarely found in the fossil record, but
distinct basal plate impressions can clearly be identified on the oospore wall of fossil and
extant forms.  Grambast (1956) recognized the phylogenetic utility of this character to
distinguish genera in the Characeae.  Before that time it was thought that all members of
Chareae possessed a simple basal plate (1-celled) and Nitelleae a multipartite (2 or 3-
celled) basal plate.  Subsequently, Daily (1969) showed that the basal plate could be
either simple (as in Chareae) or multipartite (as in Nitelleae) in the living species of
Tolypella and the distribution of this character was consistent with the sectional
classification of the genus, Tolypella section Tolypella (= Obtusifolia) with a multipartite
basal plate and section Rothia (= Acutifolia) with a  simple basal plate.  Sawa and Frame
(1974) presented a survey of several Tolypella species confirming Daily?s work and
75
proposed a hypothesis of basal plate development for the Characeae.  With a clear
understanding of extant Tolypella oospore morphology, it became possible to unite fossil
and extant forms whereby the fossil genus Sphaerochara, with a simple basal plate, was
placed in synonymy with Tolypella sect Rothia (Feist and Grambast-Fessard, 1982).
Both sections of Tolypella are found in the fossil record, section Rothia (as
Sphaerochara) from the Early Cretaceous (Hauterivian) (Wang, 1965) and section
Tolypella from the Late Cretaceous (Maastrichtian) (Uliana and Musacchio, 1978).
Single versus multiple calibration points
The a priori calibration constraints discussed above ranged in age from the Upper
Early Cretaceous for Nitella to the Early Quaternary (Pleistocene) for Nitellopsis obtusa
(Table III-2).  The BI-ML tree topology was used to explore the relative contribution of
each calibration constraint to the result using all calibration constraints simultaneously
(Figure III-X).  The individual 95% credibility intervals for each clade overlapped to
form a continuous distribution covering a relatively large time interval.  These time
intervals were substantially reduced for the combined analysis, an expected result given
that the addition of more information should act to increase overall precision and
accuracy.  The analysis using the Lamprothamnium constraint alone produced extreme
results, possibly due to an inaccurate fossil date, taxon sampling, and/or tree topology.
An active debate exists in the literature regarding the delimitation of the genus
Lamprothamnium in the fossil record.  Both extant Lamprothamnium and fossil
Aclistochara possess a deep apical peripheral grove, are cylindrical, and are
unornamented.  These characters lead Souli?-M?rche (1979) to unite these genera,
effectively extending the age of Lamprothamnium to the Jurassic.  On the other hand,
76
Feist and Grambast-Fessard (1982; 1991) argued that the overall size and narrower apical
zone of Aclistochara better resembles members of extinct Porocharaceae, and they
maintained two distinct genera.  If fossils of Lamprothamnium are not easily
distinguishable, the calibration date used in this study may belong to an older distantly
related lineage.  Lamprothamnium has been recognized as a genus separate yet closely
related to Chara (Wood, 1965); however, the molecular data place Lamprothamnium
within Chara (see above).  If Lamprothamnium is truly sister to Chara and not imbedded
within it, then branch length reconstruction becomes an important consideration, as
inaccurate topology and branch lengths would lead to inaccurate divergence time
estimates.  Both the BI-ML and constrained tree topologies force the absolute age of
Lamprothamnium to the upper bound of the a priori distribution (Tables III-4a, III-4b),
suggesting potential conflict between the fossil and molecular data.  The individual
analyses using Nitellopsis, Tolypella, and Nitella consistently estimated
Lamprothamnium diverging more recently than interpreted in the fossil record (4.7 ? 2.5,
12.6 ? 6.0, 4.1 ? 1.8 MYA, respectively).  It is also possible that the molecular data do
not adequately represent extant Lamprothamnium diversity, effectively underestimating
the age of the genus.  Additional molecular data are needed to resolve the phylogenetic
placement of Lamprothamnium with respect to Chara and a critical reassessment of the
Chara/Lamprothamnium fossil record is necessary.
Proterozoic origin and diversification of the Charophyta
The Bayesian relaxed clock approach estimated the Charophyta/Chlorophyta split
to occur 1,144.6 ? 173.72 MYA in the Middle Proterozoic.  The lineage that gave rise to
Mesostigmatales diverged shortly thereafter (1,003.9 ? 153.82 MYA) followed by
77
Chlorokybales (928.64 ? 143.71).  The remaining major extant lineages of the
Charophyta diverged in the Late Proterozoic including the split of the Charales/land plant
common ancestor (674.15 ? 99.69) (Table III-4a, Figure III-2).
The Late Proterozoic represents a remarkable interval of evolutionary change with
taxonomic diversity that far exceeds any earlier era (Knoll, 1996).  Well-preserved fossils
attributed to the red-algal bangiophyte lineage have been identified from the Hunting
Formation, Somerset Island, Canada (1,250-750 MYA) (Butterfield et al., 1990).  Other
multicellular algae of uncertain taxonomic affinity are known from the mudstones of the
Lakhanda Group, eastern Siberia (1,000-900 MYA) (Knoll, 1992; Knoll, 1996).  The
earliest putative unicellular and filamentous green algal fossils come from the Bitter
Spring Formation, central Australia (~900 MYA) (Schopf, 1968; Schopf and Blacic,
1971).  Somewhat younger shales from the Svanbergfjellet Formation, Spitsbergen,
(~750 MYA) preserve algae with significant similarity to chlorophyte green algae such as
Cladophora and Coelastrum (Butterfield et al., 1988).  The oldest Charales fossils bear
striking similarity to extant forms, which indicates that major features of the Charales
were already established in the Silurian.  Overall, it is not surprising that early
cladogenesis in the Charophyta (Figure III-2) is found in the Late Proterozoic.
The rise of atmospheric oxygen in the Late Proterozoic has been attributed to
increased cyanobacterial production and correlated with increased diversity of eukaryotic
phototrophs, possibly leading to the Cambrian explosion of animals (Knoll, 1992).
Results presented here make it possible to add another piece to this already complex
puzzle and suggest that the charophyte algae also may have played a key ecological role
during the Late Proterozoic.
78
Diversification of land plants
Consistent with the fossil record (Graham, 1993; Grey, 1993; Kenrick and Crane,
1997a) and other land plant molecular divergence times studies (Goremykin et al., 1997;
Martin et al., 1993; Sanderson, 2003; Sanderson and Doyle, 2001), the results presented
here suggest that extant land plants diverged 497.78 ? 75.66 MYA.  Using protein
sequences from fungi, animals and green plants, Heckman et al. (2001) presented a
divergence time estimate of 703 ? 45 MYA for mosses and vascular plants.  This result
was particularly surprising not only because it is nearly 200 million years older than the
oldest land plant fossil but also because, if hornworts and liverworts diverged before the
moss/vascular plant clade (as suggested in Figure III-1), then the divergence time for the
earliest land plants would be even older.  Taxon sampling and choice of fossil constraints
might explain this disparity (Sanderson, 2003).  Heckman et al. (2001) included only one
chlorophyte (Chlamydomonas) and no charophyte green algae and age constraints were
derived from either the fungal fossil record or the crown group node of animals, plants,
and fungi [which was in turn derived from a divergence time study of vertebrates (Wang
et al., 1999)].  Though Sanderson (2003) found few differences between strict and
relaxed clock analyses for 27 plastid proteins from land plants, reanalyzing the nuclear
protein data used by Heckman et al. (2001) under a relaxed clock could result in younger
age estimates.  For example, strict clock estimates presented here were consistently older
(Table III-4a, III-4b), and estimated the land plant divergence time at 526.31 ? 79.34
MYA, nearly 30 million years older than under the relaxed clock.
The Bayesian relaxed clock estimates presented here are generally congruent with
other fossil information not used as calibration constraints.  As mentioned above, the
79
oldest land plant microfossils are from the Ordovician and fall within the divergence time
estimate (497.78 ? 75.66 MYA).  The hornworts diverged 490.37 ? 76.43 MYA and the
mosses diverged 418.00 ? 68.07 MYA, consistent with Early Silurian (latest Llandovery,
~432 MYA) to Early Devonian (mid Lochkovian, ~ 402 MYA) fossils of individually
dispersed, simple spores, which are found in modern-day hornworts and some mosses
(Grey, 1993).  The Late Silurian also marks a period of dramatic increase of spores and
megafossils that document the appearance and diversification of many important vascular
plant groups (Kenrick and Crane, 1997a).  These include the now extinct
Protracheophytes and Rhyniopsids as well as lycopsid fossils in the Silurian-Devonian
boundary (Kenrick and Crane, 1997b).  The molecular divergence time estimate for
tracheophytes (389.92 ? 64.71) is consistent with this fossil evidence.  The
Euphyllophytes (341.44 ? 58.59), Moniliformopses (263.36 ? 48.63) and seed plant
clades (230.88 ? 43.85) show age estimates all slightly younger than the fossil record,
Early, Middle, and Late Devonian, respectively (Kenrick and Crane, 1997a).  Limited
taxon sampling coupled with extinction should be considered when interpreting these
results, as only a few exemplar taxa were used as placeholders for major lineages within
land plants.  Greater extant species (and molecular) diversity exists within the land plants
than sampled here.  Given this limitation, a remarkable level of consistency between the
land-plant fossil record and the molecular divergence times was recovered.
The Charales divergence time was estimated at the Permian/Triassic boundary
(247.74 ? 25.98 MYA) and this is supported by the occurrence of slightly younger
Aclistochara (Characeae) from the Late Triassic (Liu and Chen, 1992).  Similarities
between living Coleochaete and Silurian-Devonian Parka decipiens have been proposed,
80
but their taxonomic placement remains unresolved (Graham, 1993; Hemsley, 1990;
Niklas, 1976; Taylor and Taylor, 1993).  Parka shares a discoid habit and corticated
reproductive structures with some Coleochaete species, but ultrastructural differences in
spore wall morphology suggest that Parka may be more closely related to modern
liverworts (Graham, 1993; Hemsley, 1989).  The molecular divergence times for
Coleochaete and the liverwort lineage are nearly identical (460.12 ? 72.56 and 475.40 ?
81.09, respectively) with both being slightly older than the Parka fossil record.  These
dates unfortunately do not directly contribute to resolving the phylogenetic affinities of
this enigmatic fossil.
Although there are no fossils unequivocally attributed to the Charales or land
plants prior to the Ordovician, the Charales/land plant divergence time presented here
(674 ? 99.69 MYA) might serve as a guide for fossil hunters to explore these sediments
for land plant progenitors.  Decay resistant polyphenolics and compounds similar to
sporopollenin and lignin are found in living Zygnematales, Coleochaetales, Charales, and
land plants (Delwiche et al., 1989; Graham, 1996; Kodner and Graham, 2001; Kroken et
al., 1996).  These compounds likely arose as an adaptive response to periods of
desiccation, and given their distribution in extant taxa, such compounds might be found
in Late Proterozoic rocks.  Thus far, the fossil record has contributed little toward
understanding the transition of green algae to the land, but further exploration of Late
Proterozoic sediments may reveal insight into the early origin of the Charophyta and
ultimately their descendants, the land plants.
81
Chapter IV:  Phylogeny of Nitella (Charales: Charophyta)
Introduction
Overview
Commonly called stoneworts or brittleworts, the extant Charales are an
evolutionarily important lineage not only in regard to their close relationship with
embryophytes (Chapter II, Chapter III), but also with respect to their rich species
diversity (Wood, 1965) and extensive fossil record (Feist and Grambast-Fessard, 1991;
Grambast, 1974; Horn af Rantzien, 1959; Peck, 1953; Taylor et al., 1992).  The Charales
have attracted interest since the time of Plinius (1469) but were only later clearly
diagnosed in the herbal of Bauhin (1623), as Equisetum foetidum sub aqua repens (i.e.,
an embryophyte). Vaillant (1721) assigned them to a new genus, Chara, which was later
retained by Linnaeus (1753), who recognized four species.  Currently the extant Charales
contain one family, Characeae Ag., with two tribes and six genera; Chareae (Leonh.)
Zanev. including Chara L., Lamprothamnium J. Groves, Lychnothamnus (Meyen)
Leonh., and Nitellopsis Hy, and Nitelleae Gant. with Nitella Ag. em. A. Br., Leonh, and
Tolypella (A. Br.) A. Br.
The Characeae often form a significant part of the submerged vegetation in slowly
moving streams, ponds, and lakes throughout the world in all continents except
Antarctica (Wood, 1965) and are commonly the first macrophytic vegetation to occupy
new or recently inundated freshwater bodies (Crawford, 1977; Guerlesquin, 1991;
Keiner, 1944; Wood, 1952).  The Characeae often display complex species zonation in
relation to depth and water clarity (Blindow, 1992; Corillion, 1957; de Winton et al.,
82
1991; Hutchinson, 1975; Schwarz et al., 2002; Spence and Crystal, 1970; Wood, 1950b).
While typically found at depths less than 10 meters (Round, 1981), they have been
reported growing as deep as 60 meters and are often the deepest macrophytic inhabitants
of clear lakes (Dale, 1986; de Winton et al., 1991; Guerlesquin, 1991; Hutchinson, 1975;
Starling et al., 1974; Vant et al., 1986).  Some species, especially those in the genus
Lamprothamnium, are found in brackish to hyper-saline waters, where they can by quite
abundant (Corillion 1975, Brock 1981, Comin et al. 1993).
The genus Nitella is cosmopolitan and generally occurs in mildly acid or neutral
freshwater environments (Corillion, 1957; Imahori, 1954; Olsen, 1944; Pal, 1932; Wood,
1965; Zaneveld, 1940).  Fossils attributed to Nitella are represented from the Lower
Cretaceous, Albian 112-99 MYA (Horn af Rantzien, 1957) and thalli with similar overall
form date to the lower Devonian (Palaeonitella, 395-400 MYA) (Taylor et al., 1992).
Modern Nitella exhibit a broad range of gross morphological diversity, from thalli with
whorls of loosely arranged undifferentiated branchlets, to complex patterns of branchlet
divisions (furcations), which can form dense tufts.  Using scanning electron microscopy
(SEM), intricate patterns found on the oospore membrane have been used to delineate
species (C?ceres, 1975; Casanova, 1991; Garc?a, 1998; John and Moore, 1987; Leitch et
al., 1990; Mandal and Ray, 1999; Mandal et al., 1995; Mukherjee and Ray, 1993; Nozaki
et al., 1998; Ray et al., 2001; Sakayama et al., 2004; Sakayama et al., 2002).  The
monoecious or dioecious condition and the arrangement of gametangia (conjoined or
sejoined) also have been extensively utilized in circumscribing species.
Given this morphological diversity it is not surprising that numerous taxonomic
treatments have been proposed that date back to the older botanical literature (Allen,
83
1954; Braun and Nordstedt, 1882; Groves and Bullock-Webster, 1920; Halsted, 1879;
Robinson, 1906; Wood, 1951; Wood, 1962; Zaneveld, 1940).  The most recent and
comprehensive treatment radically altered the classification of Nitella and of the
Characeae in general (Wood, 1965).  In this worldwide monograph, Wood (1965, p. 26)
delimited taxa based on ?macroscopic and microscopic general morphology? rather than
key characters (e.g., synapomorphies).  As a result, he reduced the approximately 180
then recognized Nitella species to intra-specific ranks (i.e., variety or forma) or
submerged them in synonymy yielding just nineteen broadly defined species.  Wood
(1965) argued that many species represented a continuum of morphological characters
and suggested that ?genetically isolated? populations contributed to the complex pattern
of morphological variation, but that this variation did not delineate true species.  This
concept has been challenged within the genus Chara.  Data generated by numerous
crossing experiments (McCracken et al., 1966; Proctor, 1970; Proctor, 1971; Proctor,
1972; Proctor, 1975; Proctor, 1980; Proctor et al., 1971; Proctor and Wiman, 1971)
support greater species diversity than that proposed in Wood (1965).
The nineteen Nitella species recognized by Wood (1965) were divided into three
subgenera (Nitella, Hyella, and Tieffallenia), and further separated into fifteen sections.
The number and morphology of the cells following the last branchlet furcation, called a
dactyl, were emphasized to define: (1) subgenus Nitella with single-celled dactyls, (2)
subgenus Hyella with multi-celled (2-5) dactyls that terminate with allantoid-shaped
cells, and (3) subgenus Tieffallenia, also with multi-celled dactyls (but generally
restricted to two or sometimes three) that terminate with reduced, acute-shaped cells
(Figure IV-1).
84
Figure IV-1.  Hypothetical evolutionary sequence of Nitella sensu Wood (1965).
(1a), Evolutionary relationships among subgenera and sections of Nitella as hypothesized
in Wood (1965) showing three subgenera (yellow boxes) and fifteen sections (black text).
Note genus Tolypella (blue box) is tentatively placed within Nitella possibly derived from
section Migularia.  (1b), Nitella ?tasmanica? KGK0078 (subgenus Hyella), showing
female gametangia and multi-celled, allantoid-shaped dactyls (inset black box magnified
below).  (1c), Nitella hyalina KGK0272 (subgenus Tieffallenia), showing both male and
female gametangia and two-celled dactyls with reduced end cells (inset black box
magnified below).  Note that many of the end cells have fallen off giving the appearance
of both single- and two-celled dactyls.  (1d), Nitella clavata KGK0232 (subgenus
Nitella), showing single-celled dactyls with acuminate apex (inset black box magnified
below).
85
86
Wood (1965) relied on general vegetative morphology including dactyl
morphology, patterns of branchlet furcation, and characteristics of the gametangia to
delineate sections within Nitella.  Though this classification is controversial, Wood
(1965) brought together valuable morphological and distributional information and
provided testable hypotheses toward understanding evolution, diversity and biogeography
within this ancient group.
Several molecular-based phylogenetic studies have been published explicitly
addressing generic relationships within the Characeae (McCourt et al., 1996a; McCourt et
al., 1996b; Meiers et al., 1997; Sanders et al., 2003), and species relationships within
Chara (McCourt et al., 1999; Meiers et al., 1999) and Nitella (Sakayama et al., 2004;
Sakayama et al., 2002).  Sakayama et al. (2002, 2004) investigated oospore membrane
morphology using SEM and plastid encoded gene phylogenies to test the taxonomic
scheme of Wood (1965).  Their results suggested that the taxonomic system of Wood
(1965) is unnatural, at least at the sectional level in subgenus Tieffallenia.  Conclusions
from these studies, however, are restricted by a limited number of Nitella species (19)
and accessions from a limited geographic region (12 from Japan).  To better understand
diversity and evolution within Nitella worldwide, more extensive taxon sampling is
necessary.  Here a molecular phylogenetic analysis is presented using rbcL sequence data
that more fully represents the worldwide diversity of Nitella.
87
Materials and Methods
DNA isolation, PCR, and sequencing
DNA was isolated from both living material and from dried herbarium specimens.
Voucher material has been deposited in the University of Maryland Norton-Brown
Herbarium (MARY).  Epiphytes were removed under a Zeiss Stemi 2000-C dissecting
microscope with tweezers or by brushing with a fine-haired paintbrush.  To remove
excess mucilage produced by some Nitella species, thalli were placed in glass Petri dishes
containing 1% w:v N-acetyl-L-cysteine (Sigma A-7250) buffered with 2.0 mM HEPES
pH 7.2 (Sigma H-7006) for ten minutes or until mucilage dissolved.  After removing
epiphytes and excess mucilage all living material was rinsed with a steady stream of de-
ionized water, blotted with tissue to remove excess water, and placed in 1.7 ml centrifuge
tubes at ?20? C until time of extraction.  Epiphytes were also removed from dried
herbarium specimens when possible.  Dried specimens, however, were often too delicate
and brittle to manipulate extensively, therefore only the cleanest part of the herbarium
specimen was selected and stored dry at room temperature until time of extraction.
DNA was extracted from frozen or dried thalli (0.01-0.1g) with the Nucleon
Phytopure resin-based extraction kit using the protocol provided for small samples
(Amersham Pharmacia, Uppsala, Sweden) with one modification.  Rather than grinding
tissue in liquid nitrogen, frozen or dried tissue was ground directly in 200 ?l ?Reagent 1?
until homogeneous, after which an additional 400 ?l was added.  The remainder of the
manufacturer?s protocol was followed without modification.  Quality of the extracted
DNA was assessed via agarose gel electrophoresis and ethidium bromide staining.
88
Amplification of rbcL was performed in two ways.  Initially, the polymerase
chain reaction (PCR) was attempted on all samples with primers RH1
[ATGTCACCACAAACAGAAACTAAAGC: (Zurawski and Clegg, 1987) and 1385R
[AATTCAAATTTAATTTCTTTCC; (Manhart, 1994)].  Often DNA isolated from dried
herbarium material did not amplify with the RH1-1385R primer pair and two individual
reactions were required, each amplifying a smaller fragment of the gene: (1) with primer
RH1 and Characeae specific primer rbcL-972R (ATCACCACCAGAAAGACGAAG)
and (2) Characeae specific primer rbcL-295F (GCATATGTTGCTTATCCTCTT) and
1385R.  These reactions yielded fragments which over lapped by 638 base pairs (bp),
excluding primers.  The resulting PCR products were purified using a modified
polyethylene glycol (PEG) precipitation (Morgan and Soltis, 1993).  An equal volume of
20% w:v PEG 8000, 2.5 M NaCl was added to each PCR product, vortexed briefly and
spun at 16,000g for 15 minutes.   The solution was removed and the resulting DNA pellet
was washed once with 70% cold ethanol.  After removing the ethanol, the pellet was air-
dried and resuspended in 25 ?l de-ionized water.   The PEG-purified PCR product was
quantified via agarose gel electrophoresis and ethidium bromide staining for subsequent
sequencing reactions.
Sequencing reactions were performed in 7 ?l final volume (3.0 ?l PEG-purified
PCR product, 0.7 ?l de-ionized water, 1.3 ?l 2.5 ?M primer, 1.5 ?l 5X buffer [400 mM
Tris pH 9.0, 10 mM MgCl
2
], 0.5 ?l BigDye Terminator Ready Reaction Mix v2 [Perkin
Elmer Biosystems, Foster City, CA]), cycled and purified according to the
manufacturer?s protocols and resolved using either an ABI 377 slab gel sequencer
(performed by the University of Maryland Center for Agricultural Biotechnology) or an
89
ABI 3100 capillary sequencer.  Sequences were determined initially on single strand
reads using primers RH1 and 1385R.  The resulting sequences were edited and compiled
with the computer program Sequencher 3.1.1 (Gene Codes Corporation, Ann Arbor, MI).
If sequences from multiple isolates of the same species were found to be identical, one
individual was arbitrarily chosen for further sequencing.  All unique sequences including
an individual representative of multiple isolates of the same species were then determined
on the complimentary strand with primers rbcL-670F
(GCAATTTATAAATCTCAAGCAG) and rbcL-751R
(GCATTTCTTCACAAGTTCCTG).
Newly determined sequences were combined with sequences from the literature.
Twenty rbcL sequences representing twelve species of Nitella have been published
previously (one sequence, Manhart, 1994; three sequences for three species, McCourt et
al., 1999; twenty eight sequences for sixteen species, Sakayama et al., 2002; 2004).  The
sequence from Manhart (1994) was identified as N. translucens (Genbank accession
number L13482); however, this sequence showed strong affinity with N. axillaris and
not N. translucens (results not shown).  Because a voucher for this specimen could not be
found to confirm identification, L13482 was not included in this study.  Sequences from
Sakayama et al. (2002; 2004) were shorter than those presented here (1194 bp versus
1353 bp, respectively), therefore, identical sequences determined for this study from the
same species were included in place of the shorter sequences.  Outgroup taxa were
selected to represent the diversity of embryophytes and include all published
Coleochaetales rbcL sequences.  To facilitate comparison with other studies,
embryophyte taxa were selected to match those used in Chapter III and Coleochaetales
90
sequences were derived from Turmel et al. (2002a), Delwiche et al. (2002) and Cimino
and Delwiche (2002).   All sequences were aligned by hand and no insertion/deletion
events or internal stop codons were detected.  A summary of species and source
information is shown in Appendix II.
Phylogenetic analyses
Phylogenetic analyses were performed using two computer programs: (1) PAUP*
4.0b10 (Swofford, 2002) was used for maximum parsimony (MP) and maximum
likelihood (ML) analyses, and (2) MrBayes 3.0b4 (Huelsenbeck and Ronquist, 2001) was
used for Bayesian inference (BI).  For MP analyses characters were unordered and
assigned equal weights at all sites (Fitch, 1971).  Ten heuristic search replicates were
performed with random-taxon-addition, tree bisection reconnection (TBR) branch
swapping, steepest decent and ?MulTrees? options in effect.  For ML and BI analyses,
Modeltest 3.06 (Posada and Crandall, 1998) was used to select among 56 nested models
of sequence evolution.  Under the Akaike information criterion (AIC), the best fitting
model was found to be the general-time-reversible model with invariant sites and gamma
distributed rates for variable sites (GTR+I+?).  A ML heuristic search using this model
and parameters values estimated by Modeltest was performed with a single random taxon
addition sequence, nearest-neighbor-interchange (NNI) branch swapping and steepest
descent option active.  Parameters were re-estimated using the resulting tree, and three
iterative searches were performed until they converged on similar values.  These values
were then fixed and used for a ML analysis with three heuristic search replicates,
random-taxon-addition, tree-bisection-reconnection (TBR) branch swapping, steepest
decent and ?MulTrees? options in effect.
91
One hundred bootstrap pseudoreplicates were generated using CodonBootstrap
3.0b4 (Bollback, 2001), taking into account protein-coding portions (codons) of the
dataset, and used for MP  and ML bootstrap analyses (Felsenstein, 1985).  MP bootstrap
replicates were each performed with three random-taxon-addition TBR heuristic searches
and ML bootstrap replicates were performed each with three random-taxon-addition NNI
heuristic searches using parameter values described above.
MrBayes uses a Metropolis-coupled Markov chain Monte Carlo (or MCMCMC)
algorithm to generate an approximation of the posterior probability distribution of
phylogenies.  Two models implemented in MrBayes were examined:  (1) GTR+I+? for
comparison with the ML analysis, and (2) GTR+I+? with ?covarion? option active.  The
covarion option allows the rate at a site to change at any given time over its evolutionary
history thereby allowing the pool of variable sites (I) to change across the tree.  For each
BI model, four separate runs were carried out each with four Markov chains starting from
a random tree.  Three of these chains were heated allowing for broad sampling of
parameter space.  Each run was allowed to continue for two million generations sampling
every 100 generations for a total of 20,000 samples per run.  The tree scores were plotted
against the corresponding generation number to assess that the chain had reached
stationarity.  In this way, generations sampled before the chain reached stationarity were
identified and discarded as burn-in.  Independent runs using the same model of sequence
evolution were then compared and if essentially identical tree topologies and posterior
probabilities were found, indicating convergence and appropriate mixing, the tree files
and parameter files were combined and summarized using MrBayes ?sumt? and ?sump?
commands.
92
Results and Discussion
Taxa and data set
This study presents rbcL sequence data for 177 operational taxonomic units
(OTUs) with a total length of 1,353 base pairs.  Eighty OTUs represented identical
Nitella sequences from multiple isolates of the same species and were not included in
phylogenetic analyses.  The remaining 100 representatives of Characeae included seven
Chara, three Lamprothamnium, three Lychnothamnus, two Nitellopsis, six Tolypella and
seventy-nine unique Nitella sequences.  Eight land plant and twelve Coleochaetales
sequences were used as out groups.  A character-base summary for each major lineage is
presented in Table IV-1.
93
Table IV-1.  Mean base composition values across taxa, parsimony informative
characters (PIC), parsimony uninformative characters (PUC), constant characters (CC),
total characters (Total), and number of operational taxonomic units used in phylogenetic
analyses (OTU) for Nitella, Characeae, Coleochaetales, land plants, and all taxa
respectively.
%A%C%G%TPICPUCCCTotalOTU
Nitella30152332270531030135379
Characeae30152332355439551353100
Coleochaetales31162132243871023135312
Land plants271924 27021387013538
All taxa301622
30
32530807431353120
94
All phylogenetic analyses resulted in essentially identical tree topologies with
differences associated with weakly supported nodes.  The MP analyses yielded eight
most parsimonious trees 2,767 steps in length, with a consistency index (CI) of 0.3488
and a retention index (RI) of 0.7927; ML analyses resulted in a single tree (?ln =
15459.479).  The BI tree using GTR+I+? with the covarion option active is shown in
Figure IV-2.  The monophyly of the Characeae was strongly supported in all analyses as
was monophyly of the tribe Chareae (Figure IV-3).  Unlike results presented in Chapter
III, Chara formed a monophyletic group sister to a strongly supported Lamprothamnium
clade, although support for Chara was relatively weak.  Similar to Chapter III, the tribe
Nitelleae was paraphyletic, with Tolypella sister to a clade composed of the tribe Chareae
+ Nitella.  The monophyly of Nitella showed mixed levels of support depending on
analytical method (i.e., both Bayesian analyses recovered higher support values than the
ML or MP analyses).  The clade containing Chareae + Nitella was weakly supported
under all methods suggesting the need for further data to resolve these relationships.
Within Nitella two distinct basal lineages were recovered (Figure IV-3).  One
lineage includes part of subgenus Nitella, and is comprised of the ?N. flexilis group?
(Nitella flexilis, N. mirabilis, N. missouriensis, and N. opaca) and the ?N. stuartii group?
(N. macounii, and N. stuartii).  The other lineage includes the remaining members of
subgenus Nitella sampled in this study, termed the ?N. acuminata group? (including N.
acuminata, N. bastinii, N. clavata, and N. praelonga), and all remaining members of the
genus [subgenera Tieffallenia and Hyella (Figure IV-4, 5)].  Paraphyly of subgenus
Nitella was also identified in a recent phylogenetic analysis using rbcL and atpB
sequence data with a limited number of taxa (Sakayama et al., 2004).
95
Morphological characters have not been identified that clearly separate the N.
flexilis/N. stuartii lineage from the remainder of Nitella, however, chromosome number
may be a useful synapomorphy marking this basal split.  The base chromosome number
for Nitella is likely x = 3, or possibly x = 6 (Guerlesquin, 1967) and monoecious species
of the Characeae generally have twice the chromosome number as their dioecious
counterparts (Gillet, 1959; Guerlesquin, 1967; Hotchkiss, 1963; Imahori and Kato, 1961;
Tindall, 1967: Tindall and Sawa, 1964).  Dioecious members if the ?N. flexilis group? (N.
missouriensis, N. opaca, N. mirabilis) have chromosome number n = 6, while
monoecious species (N. flexilis) exibit n = 12 chromosomes.  An accurate chromosome
count of N. macounii has been elusive (Mann and Raju, 2002) and n = 15 has been
reported for N. stuartii (Guerlesquin, 1967; Michelle Casanova, personal
communication), possibly representing either a duplication or reduction of the base
number of three chromosomes (from twelve or eighteen to fifteen).  The remaining
members of subgenus Nitella sampled in this study (N. acuminata, N. bastinii, N. clavata,
and N. praelonga) as well as subgenera Tieffallenia and Hyella generally have dioecious
species with chromosome number n = 9 and monoecious species with chromosome
number n = 18.  In general, the basal split in Nitella corresponds nicely with published
chromosome numbers of n = 6/12 (15) for a select few members of subgenus Nitella [the
?n = 6/12 (15)? clade], and n = 9/18 for the remaining members of this genus (the ?n =
9/18? clade).
96
FIGURE IV-2.  Phylogenetic relationships for the Charales determined by Bayesian
inference (BI), maximum likelihood (ML) and maximum parsimony (MP) analyses using
rbcL sequence data.  Values in parentheses adjacent to taxon names represent the total
number of individuals sampled with that name and identical rbcL sequence.  Values not
in parentheses represent the clone number associated with that unique sequence, and
species without numbers were represented by a single sequence (Appendix II).  BI
posterior probabilities using the GTR+I+? with the covarion option active, and GTR+I+?
(covarion option not active) are presented above branches, respectively.  ML and MP
bootstrap values for 100 replicates are presented below branches, respectively.  Support
values are only shown for the Coleochaetales, land plants, and Charales and support
values within the Charales are shown in Figure IV-2 to IV-4.  The Coleochaetales, land
plants, Chareae, and Nitelleae (Nitella and Tolypella) are shown with brackets on the
right.  The tree is rooted with the Coleochaetales and branch lengths are Bayesian mean
values from analyses using GTR+I+? with the covarion option active and are
proportional to the number of substitutions per sites.
97
98
FIGURE IV-3.  Phylogenetic relationships for basal lineages of Nitella subgenus Nitella
sensu Wood (1965) determined by Bayesian inference (BI), maximum likelihood (ML)
and maximum parsimony (MP) analyses using rbcL sequence data.  Values in
parentheses adjacent to taxon names represent the total number of individuals sampled
with that name and identical rbcL sequence.  Values not in parentheses represent the
clone number associated with that unique sequence, and species without numbers were
represented by a single sequence (Appendix II).  Black dots at nodes show inferred
ancestral chromosome number.  BI posterior probabilities using the GTR+I+? with the
covarion option active, and GTR+I+? (covarion option not active) are presented above
branches, respectively.  ML and MP bootstrap values for 100 replicates are presented
below branches, respectively.  The top left inset is identical to Figure IV-2 and the shaded
box shows the magnified area of the tree.  Branch lengths are Bayesian mean values from
analyses using GTR+I+? with the covarion option active and are proportional to the
number of substitutions per sites.
99
100
The ?n = 6/12 (15)? clade
Sectional relationships (sensu Wood) within the ?n = 6/12 (15)? clade were
difficult to reconcile with the rbcL phylogeny.  According to Wood (1965), section
Nitella includes three species (Nitella flexilis, N. mirabilis, and N. macounii), several
varieties, and numerous formas.  The eleven isolates of monoecious N. flexilis, from
Germany, Japan, and the United States, shared identical rbcL sequences and were found
sister to dioecious N. missouriensis from southwestern U.S. (Figure IV-3).  The
placement of N. missouriensis close to N. flexilis is contrary to Wood (1965), who placed
N. missouriensis in synonymy with N. acuminata in section Rajia (?n = 9/18? clade).
Two isolates of dioecious N. opaca, one from Poland and a first report from New
Zealand, were resolved sister to the N. flexilis/N. missouriensis clade (Figure IV-3).  The
most apparent morphological character uniting N. flexilis, N. missouriensis, N. mirabilis,
and N. opaca is the distinctive oogonial jacket cells that are apically swollen at maturity
(Wood, 1965).
Wood (1965) did not consider sexual state to be an important criterion for species
delineation and N. flexilis and N. opaca are not easily distinguished if fertile material is
unavailable (or ignored); consequently Wood (1965) placed N. opaca in synonomy with
N. flexilis.  Detailed cytological evidence of both N. flexilis and N. opaca from the U.S.
supported N. opaca as a distinct species separate from N. flexilis and further supported
the utility of sexual state as a species-level character, at least for this complex (Sawa,
1965).
101
Oospore membrane ornamentation also reveals a close relationship of the ?N.
flexilis group.?  Horn af Rantzein (1959) recognized the distinctive nature of Nitella
flexilis when he used LM to describe the oospore membrane as ?minutely and very
obscurely granulate, faveolate or smooth.?  Subsequent SEM studies have revealed a
smooth to spongy oospore surface for N. flexilis and N. opaca (Frame, 1977; Leitch et al.,
1990).  Sakayama et al. (2004) described the oospore surface of N. mirabilis from Japan
as finely granulate under LM, but demonstrated that a network of fibrils forming a
sponge-like network was present under SEM.  A granulate oospore membrane has been
described for N. missouriensis using LM (Allen, 1954), however conformation using
SEM is needed. The phylogenetic position of N. opaca sister to the N. flexilis/N.
missouriensis clade (not imbedded among the eleven N. flexilis isolates) adds further
evidence for the species-level status of this taxon (Figure IV-3).
Mann and Raju (2002) reported sixteen new localities for the rare ephemeral
Nitella macounii (T. F. Allen) T. F. Allen and clarified several poorly understood
morphological characters, including dactyl number and shape, oospore ornamentation,
and antheridia morphology.  Nitella macounii exhibited single-celled dactyls with both
acute and acuminate apices (Mann and Raju, 2002), contrary to reports of multicelled
dactyls (Allen, 1888; Wood, 1965; Wood and Imahori, 1964).  The multicelled condition
may have been a misinterpretation of incomplete abscission and/or suppressed furcation
producing the appearance of multicelled dactyls (Allen, 1954; Mann and Raju, 2002).
The oospore membrane surface under SEM showed a range of morphological variation
from reticulate to tuberculate (Crum, 1975; Frame, 1977; Mann and Raju, 2002).  This
variation appeared to be correlated with oospore color and possibly maturity; lighter and
102
presumably younger oospores were incompletely reticulate while the darkest/most mature
oospores were generally tuberculate (Mann and Raju, 2002).  Finally, antheridia of N.
macounii were composed of four shield cells (scutes), rather than the common condition
for the Characeae of eight.  Only a few Nitella species (N. stuartii A. Br., N. terrestris
Iyengar, N. quadriscutulum Jao and Li, and N. cordobensis C?ceres) and one Chara
species (Chara zeylanica Klein ex Willd.) have antheridia composed of four shield cells
and this has been show to be taxonomically significant in clarification of the Chara
zeylanica species complex (Proctor et al., 1971).
Owing to inconsistent morphological interpretations and incomplete material, it is
not surprising that several taxonomic placements have been proposed for N. macounii.  T.
F. Allen (1888) originally suggested a close affinity with N. stuartii from New Zealand.
Wood (1965) included N. macounii in section Nitella with N. flexilis and N. mirabilis.
Tindall (1967) suggested that N. macounii belonged in a group including N. acuminata,
N. stuartii, and N. allenii.  The phylogenetic analyses presented here support N. macounii
sister to N. stuartii (section Palia), represented by two isolates from Australia and one
from New Zealand, and not closely related to N. acuminata (Figure IV-3).  Nitella
macounii shares several morphological features with N. stuartii including heteroclemous
branchlets (advantageous branchlets found in addition to the primary whorl of
branchlets), though N. macounii has been interpreted as homoclemous (Allen, 1954), or
exhibiting only a ?heteroclemous tendency? (Mann and Raju, 2002).  These species also
share two- or sometimes three-furcate branchlets with single-celled dactyls, and most
notably tetrascutate antheridia.
103
Wood (1965) considered subgenus Nitella to be a monophyletic group united by
single-celled dactyls (Figure IV-1).  The rbcL results suggest that single-celled dactyls
may represent a pliesiomorphic condition for Nitella (Figure IV-3) and chromosome
number, though not always practical, may be a more reliable character to distinguish
natural, basal lineages in Nitella.
104
FIGURE IV-4.  Phylogenetic relationships for Nitella subgenus Hyella (sensu Wood
1965) determined by Bayesian inference (BI), maximum likelihood (ML) and maximum
parsimony (MP) analyses using rbcL sequence data.  Values in parentheses adjacent to
taxon names represent the total number of individuals sampled with that name and
identical rbcL sequence.  Values not in parentheses represent the clone number associated
with that unique sequence, and species without numbers were represented by a single
sequence (Appendix II).  BI posterior probabilities using the GTR+I+? with the covarion
option active, and GTR+I+? (covarion option not active) are presented above branches,
respectively.  ML and MP bootstrap values for 100 replicates are presented below
branches, respectively.  The top left inset is identical to Figure IV-2 and the shaded box
shows the magnified area of the tree.  Branch lengths are Bayesian mean values from
analyses using GTR+I+? with the covarion option active and are proportional to the
number of substitutions per sites.
105
106
FIGURE IV-5.  Phylogenetic relationships for Nitella subgenus Tieffallenia sensu Wood
(1965) determined by Bayesian inference (BI), maximum likelihood (ML) and maximum
parsimony (MP) analyses using rbcL sequence data.  Values in parentheses adjacent to
taxon names represent the total number of individuals sampled with that name and
identical rbcL sequence.  Values not in parentheses represent the clone number associated
with that unique sequence, and species without numbers were represented by a single
sequence (Appendix II).  BI posterior probabilities using the GTR+I+? with the covarion
option active, and GTR+I+? (covarion option not active) are presented above branches,
respectively.  ML and MP bootstrap values for 100 replicates are presented below
branches, respectively.  The top left inset is identical to Figure IV-2 and the shaded box
shows the magnified area of the tree.  Branch lengths are Bayesian mean values from
analyses using GTR+I+? with the covarion option active and are proportional to the
number of substitutions per sites.
107
108
The ?n = 9/18? clade
Within the ?n = 9/18? clade two distinct subclades were recovered, one comprised
of species with single-celled dactyls (N. acuminata A. Br. ex Wallm. , N. bastinii T. F.
Allen, N. clavata K?tz, and N. praelonga A. Br.) and the other of species with
multicelled dactyls (Figure IV-3).  This latter clade is further divided into a group with
multicelled dactyls (? 3) roughly corresponding with subgenus Hyella (Figure IV-4) and
a group with just two-celled (or sometime two- and three-celled) dactyls corresponding
with subgenus Tieffallenia (Figure IV-5).
The single-celled dactyl group includes representatives from three sections sensu
Wood (1965); Brownia (Nitella clavata), Rajia (N. acuminata and N. bastinii ), and
Riddellia (Nitella praelonga).  All members of this clade share acuminate dactyl apices
and coronal jacket cells that are not apically swollen at maturity.  The two N. praelonga
isolates, one from Tamaulipas, Mexico, and the other from the Panamanian/Costa Rican
border, shared identical rbcL sequences and were found sister to a paraphyletic Rajia,
which included the only representative of section Brownia (N. clavata)  (Figure IV-3).
Nitella bastinii was thought to be unknown since its discovery on the grounds of the 1890
Chicago World Fair (Wood, 1965), however, it has subsequently been reported from
Iowa by Crum (1975), and discovered to be wide spread in Llano Estacado (High Plains
of the Texas Panhandle and adjacent New Mexico) (Proctor, 1990).  The rbcL data placed
the single representative of N. bastinii from Texas, sister to a clade including N. clavata
and several isolates of N. acuminata.
109
Four isolates of N. acuminata were sampled, one from Japan (Sakayama et al.,
2004), two collected by Vernon Proctor from different localities in Costa Rica, and a
fourth from northern Wisconsin.  The isolates from Costa Rica and Wisconsin exhibited
axillary and rarely terminal reduced fertile heads corresponding to N. acuminata var.
greenii R.D.W., and axillary fertile heads were reported lacking from the Japanese isolate
(Sakayama et al., 2004), consistent with N. acuminata var. acuminata f. acuminata [sensu
Wood (1965)].  The rbcL phylogeny resolved the two isolates from Costa Rica sister to
the Japanese isolate.  The Wisconsin isolate was found sister to these.  Support within the
N. acuminata clade was relatively weak, but monophyly of the species complex was
strongly supported (Figure IV-3).  The N. acuminata group includes numerous described
?species? exhibiting considerable morphological variation and Wood (1965) emphasized
dactyl size (reduced or elongate) and the presence of axillary fertile heads to circumscribe
subspecific groups in this taxon.  Observations of cultured material (Tindall, 1970)
demonstrated that light and temperature were key factors in development of these
characters, and suggested that species collected from southwestern United States and
northern Mexico were conspecific.  Interestingly, all of the samples studied by Tindall
(1970) were monoecious and had chromosome number n = 9, not n = 18 as previously
reported for the ?same? monoecious species from northern United States (Hotchkiss,
1958; Wood, 1954), Japan (Imahori and Kato, 1961; Sasaki, 1961), India (Sarma and
Khan, 1964), and Fiji (Hotchkiss, 1965).  Oospore ornamentation for the n = 9 isolates
was described as finely granulate under LM (Tindall, 1970); however, SEM revealed a
scabrous oospore surface composed of irregularly arranged projections for N. acuminata
var. greenii (Leitch et al., 1990) and N. acuminata var. acuminata (Sakayama et al.,
110
2004).  Detailed analyses of species in the N. acuminata group using a combination of
chromosome counts, SEM oospore ornamentation, and molecular phylogentic methods
are needed to elucidate the taxonomy and evolutionary history of this species complex.
Subgenus Hyella
Figure IV-4 presents the rbcL phylogeny for all members of Nitella that share
equal to or greater than three cells per dactyl.  Species in this clade generally correspond
with those of subgenus Hyella R.D.W. with two major exceptions.  Despite having
multicelled dactyls, Wood (1965) emphasized the conical shape of the dactyl apices and
included Nitella cristata A. Br. em. in subgenus Tieffallenia, section Migularia.  Nitella
hookeri A. Br. was grouped in subgenus Nitella, section ?Incertae? with single-celled
dactyl species because sufficient material was not available to arrive at a satisfactory
revision of this species (Wood, 1965).  Subsequent examinations of N. hookeri material
led Wood and Mason (1977) to dismantle section ?Incertae? and place N. hookeri in
section Migularia along with N. cristata in subgenus Tieffallenia.  The rbcL data placed
N. hookeri, N. hookeri var. tricellularis Nordst., N. cristata, and N. cristata f. diffusa (A.
Br.) R.D.W. with other multicelled-dactyl species in subgenus Hyella.  Wood emphasized
dactyl end-cell shape (conical vs. allantoid) rather than dactyl cell number (two vs.
numerous) when placing these species in Tieffallenia, but data presented here support the
inclusion of all taxa with multicelled dactyls in a single, strongly supported,
monophyletic group (Figure IV-4).
Nitella hookeri and N. hookeri var. tricellularis cannot be differentiated with the
rbcL data alone; however, branchlet morphology can be used to distinguish between
111
these two taxa.  Plants with clearly furcate sterile branchlets, and slightly compacted
fertile branchlets that do not form dense heads characterize N. hookeri.  Plants with
simple or brachydactylous sterile branchlets, and compact fertile heads, characterize N.
hookeri var. tricellularis.  Nine populations of N. cristata from New Zealand were
identical to two populations from Victoria and another from New South Wales, Australia
(Figure IV-4).  Sister to these was a clade including several populations of N. cristata
from New South Wales and N. cristata var. diffusa.  The specimens in the New
Zealand/Australia clade share specialized reduced primary branchlet segments that are
packed with starch grains and appear opaque.  These opaque segments (often called
?opaque dactyls?) function as vegetative reproductive units, easily dehiscing and
developing into new plants.  The type specimen of N. cristata from Tasmania was
examined by Michelle Casanova (personal communication) and discovered to differ from
members in the New Zealand/Australia clade in vegetative morphology and oospore
ornamentation.  This distinction, along with the rbcL phylogeny, suggests that that N.
cristata in New Zealand and some populations in southern Australia likely represent a
new species.  Further analysis of the N. cristata complex including chromosome counts,
oospore ornamentation, and morphological descriptions, is currently underway and
should help resolve the nomenclature for this taxon (Michelle Casanova, in prep.).
Excluding N. cristata and N. hookeri, eight species with only a few varieties and
several forms are currently recognized for subgenus Hyella (Wood, 1965; Wood, 1972;
Wood and Mason, 1977).  Owing to the relative paucity of collections and little-
understood morphological variation, this subgenus has not been further divided into more
restrictive sectional groups (Wood, 1965; Wood, 1972; Wood and Mason, 1977).  Of
112
these eight species, rbcL sequence data have been assembled here from thalli
morphologically identifiable as N. pulchella Allen (Sakayama et al., 2004; Sakayama et
al., 2002), N. leptostachys var. leonhardii (R.D.W.) R.D.W., N. leptostachys A. Br. em.,
N. tasmanica M?ll. ex. A. Br. em., N. tasmanica ssp. gelatinifera R.D.W., and N.
tasmanica ssp. gelatinifera var. microcephala (A. Br.) R.D.W.  A further five unique
rbcL sequences have been determined from plants that are either difficult to identify to
species or correspond to no known species description (Figure IV-4; Appendix II).
The rbcL phylogeny shows a basal split separating the Japanese N. pulchella from
all other members in this subgenus, which is exclusively comprised of Australia and New
Zealand collections.  Three distinct lineages were recovered in the Australia/New
Zealand clade. (1) The Nitella cristata/N. hookeri clade discussed above. (2) A group
including two identical isolates of N. leonhardii sister to three identical N. leptostachys
isolates was recovered with an unidentified dioecious taxon (Nitella sp. 245).  Both N.
leonhardii samples were collected in New Zealand, while the three N. leptostachys were
collected in New South Wales, South Australia, and Victoria, respectively.  Nitella sp.
245 was collected in Tasmania and differs from N. leonhardii and N. leptostachys by
being dioecious, though all three species share reduced fertile heads and dense mucus.
(3) A weakly supported clade was recovered that includes two isolates of N. aff.
tasmanica, N. microcephala, N. gelatinifera, and four unidentified Nitella species.  Three
of the unidentified Nitella species are monoecious (Nitella sp. 175, Nitella sp. 352, and
Nitella sp. 353) and the fourth is dioecious (Nitella sp. 115).  Limited structural material
is available to resolve the taxonomy within this group, although several interesting trends
are noted in the rbcL phylogeny.  Most of the unidentified Nitella species fell within a
113
single clade.  This clade was divided into two distinct biogeographic assemblages, one
from eastern Australia, and another from southwest Australia.  It is worth noting that
southwest Western Australia is well known for its high level of vascular plant endemism
(see Flora of Australia online http://www.deh.gov.au/biodiversity/abrs/online-
resources/abif/flora/main/index.html).  Many species are found only in that small area
and an entire volume of Eucalypts of Australia is devoted to Western Australia species
(REF), while the other volume covers the remainder of Australia.  Given the occurrence
of a separate clade of species from southwestern Western Australia, and the fact that the
flora and diversity of that area are similar to that of the fynbos in South Africa, it will be
interesting to compare Nitella collections from South Africa with the Western Australia
collections.  With more collections, the possibility exists that these unidentified isolates
may be correlated with already published species.  However, as it stands, it appears that
they likely represent new taxa and warrant further research.
Another important point drawn out by the rbcL phylogeny for subgenus Hyella is
the placement of N. aff. tasmanica.  Three isolates corresponding to N. tasmanica were
sequenced for rbcL and none proved to be closely related to another (Figure IV-4).
Isolate F154 from Victoria and 355 from Western Australia were each found closely
related to other taxa from similar biogeographic regions (see above).  The third isolate
collected in New South Wales was found sister to the N. cristata/N. hookeri assemblage,
but the support for this placement was poor, likely due to the relatively long branch
associated with it (Figure IV-4).  The taxonomy of N. tasmanica is difficult to interpret.
Mislabeled specimens, lost types, and poor illustrations have compounded this difficult
problem (Wood, 1972).  Tremendous morphological variation exists within N. tasmanica
114
ranging from minute simple forms, to diffusely branched forms with fertile heads, to
robust heteromorphic forms with simple sterile branchlets and tiny fertile heads (Wood,
1972).  The three isolates studied here are morphologically consistent with this general
description, having diffusely branched sterile branchlets and reduced fertile heads.  The
rbcL data clearly place each N. aff. tasmanica isolate on separate evolutionary lineages
and these data, along with the five unique unidentified isolates, further suggest that
tremendous uncharacterized species diversity exists for subgenus Hyella.
Subgenus Tieffallenia
Based on dactyl cell number or end-cell shape, Wood (1965) divided subgenus
Tieffallenia into eight sections, and included three species in an additional group of
uncertain taxonomic affinity (Incertae).  Phylogenetic studies based on rbcL (Sakayama
et al., 2002) and rbcL and atpB combined (Sakayama et al., 2004) for subgenus
Tieffallenia, however, found results that conflict with the sectional taxonomic system of
Wood (1962; 1965).  Using taxa biogeographically limited to Japan and Malaysia,
Sakayama et al. (2004) showed that sections Tieffallenia and Gioallenia were
polyphyletic, and further suggested that oospore membrane architecture was consistent
within monophyletic groups of subgenus Tieffallenia.  Results presented here using rbcL
sequence data from a broad range of species further corroborate that sections Tieffallenia
and Gioallenia are polyphyletic.  These data also show that section Persoonia is
paraphyletic and support a monophyletic Decandollea (Figure IV-5).
Section Decandollea, represented here by Nitella hyalina (DC.) Ag., N. congesta
(R. Br.) A. Br., and N. lhotzkyi (A. Br.) A. Br. em., are often encrusted with calcium
115
carbonate and are commonly enveloped in thick mucus.  They have short, 2-3 furcate
branchlets with central secondary rays and strictly two-celled dactyls (Wood, 1965).
Most notably, heteroclemous branchlets are found in all members of this section, though
these species are not closely related to N. stuartii or N. macounii which also have a
heteroclemous tendency (see ?n = 6/12 (15) clade? discussion above).  Members of
section Decandollea also share similar fibrous oospore ornamentation (John and Moore,
1987; Nordstedt, 1891; Sakayama et al., 2004).
The rbcL results placed Nitella ignescens A. Garc?a, a recently described
dioecious species from Australia (Garcia 1998), within section Decandollea, unresolved
among an assemblage of N. hyalina and N. lhotzkyi isolates.  Nitella congesta was
strongly supported sister to these (Figure IV-5).  Nitella ignescens shares with
Decandollea mucus production, short 2-3 furcate branchlets, central secondary rays, and
2-celled dactyls.  Garc?a (1998) collected N. ignescens from the uppermost littoral zone
and reported plant size to be relatively small (3.0-5.0 cm) with mucronate dactyls,
however, specimens provided by Garc?a from several localities in Australia grew over 20
cm tall in culture, reaching the top of the culture flask, and exhibited both mucronate and
confluent dactyls similar to other members of Decandollea (not shown).  Although a
sectional affinity was not proposed, Garc?a (1998) noted that advantageous branchlets
were observed inside one of the branchlet whorls, but because these branchlets were rare,
she suggested that this was an abnormality rather than an expression of the heteroclemous
condition.  Advantageous branchlets were not observed in cultured material of N.
ignescens, but heteroclemous branchlets are often lost in cultures of N. hyalina and
especially N. lhotzkyi (personal observation) and may also have been lost in cultures of N.
116
ignescens.  Further collections and culture-based experiments are needed to resolve the
heteroclemous condition in N. ignescens.  Unique to this section, N. ignescens possesses
distinct reticulate oospore membrane ornamentation (Garc?a, 1998).
Dioecious Nitella ungula, described in the same publication as N. ignescens
(Garc?a, 1998), was found sister to section Decandollea, although the rbcL sequence was
quite divergent (Figure IV-5).  Nitella ungula differs from members of section
Decandollea in having distinctive, long end cells (to 270 ?m) that sometimes are claw-
like enclosing the gametangia.  Nitella ungula lacks mucus, does not exhibit
heteroclemous branchlets, and has vermiferous oospore ornamentation under SEM
(Garc?a, 1998).  Affinity of N. ungula with Decandollea can be found in the short 1-2
furcate branchlets, often with central secondary rays, and strictly bicellulate dactyls;
however, the divergent rbcL sequence and unique dactyl morphology might warrant a
new section for this species.  The type was collected from Lake Bathurst, New South
Wales, Australia, and also reported from Lake Muirhead, Victoria (Garc?a, 1998).  The
specimen used here for molecular analysis was collected by Michelle Casanova from
Lake Bolac, Victoria, and is a new locality for this distinctive species.
Section Muelleria contains a single species, Nitella partita Nordst., and its
phylogenetic placement has been problematic.  Nitella partita is unique among Nitella
species in that it has 2-3 partite dactyl end cells (Wood and Imahori, 1964).  Based on
illustrations alone, Wood (1965) assigned this species to its own section (Muelleria), and
later expressed uncertainty when moving it to section Tieffallenia, near N. furcata
(Wood, 1972).  Results presented here strongly suggest that N. partita is not closely
related to N. furcata, but rather is sister to a clade containing N. verticillata (section
117
Migularia), and an undescribed dioecious species (Nitella sp. 175) from Victoria,
Australia.
Nitella verticillata (p254 KGK0113) was described by Filarszky (1937) as a new
monotypic genus, Charina, using sterile and incomplete material provided by G. O.
Allen, who was seeking an opinion of the material.  James Groves thought it was a
Nitella closely related to N. subtilissima (Filarszky, 1937), and Zaneveld (1940) thought
that Charina was too badly defined to include in his treatment of the Characeae.  Wood
(1965; 1972) agreed that the available material was insufficient, but emphasized
monopodal habit and acute dactyls to align this species in section Migularia, near Nitella
cristata.  Nitella verticillata was described as monoecious, though the type material was
clearly sterile.  Specimens are not abundant, and owing to its small size it is difficult to
find.  However, Wood (1972) inadvertently collected specimens with mature oogonia
entangled with plants of Chara fibrosa Ag. ex Brux. em. from Western Australia and
thereby suggested that N. verticillata may be dioecious.  A recent discovery of N.
verticillata from Brixton Street, N.R., Western Australia, Australia, collected by Michelle
Casanova in 1996, clearly demonstrates that it is monoecious, with both male and female
gametangia on the same plant, homeoclemous, with no calcification, mucus, or heads.
Moreover, the rbcL sequence data do not show a close relationship of N. verticillata with
N. cristata (discussed under subgenus Hyella above) but sister to dioecious Nitella sp.
175.
Nitella sp. 175 will be formally described by M. Casanova in a later paper.  She
kindly provided key morphological information for this species, which is discussed
below.  Nitella partita, N. verticillata, and Nitella sp. 175 share several morphological
118
features including central secondary branchlet segments and a small, delicate habit.
Nitella sp. 175 differs from N. verticillata by its dioecious habit and end-cells that are not
much reduced and are clearly not partite, but are confluent with the penultimate cell.  The
central secondary segment is reduced in Nitella sp. 175, giving a ragged monopodal
appearance.  All three species exhibit unique oospore ornamentation.  Nitella partita has
sparsely dispersed granulae and well developed flanges; N. verticillata has verrucate
oospores and short flanges, and Nitella sp. 175 has densely packed granulate oospores
without flanges.
It is impossible to reconcile the rbcL phylogeny with sections Tieffallenia,
Gioallenia, and Persoonia sensu Wood (1965).  Members of section Tieffallenia formed
four distinct lineages dispersed among five lineages of Gioallenia and two lineages of
Persoonia (Figure IV-5).  Several clades, however, are consistent with those proposed by
Sakayama et al. (2004) and correlate with oospore morphology.  Sakayama et al. (2004)
identified a clade including N. pseudoflabellata and N. megaspora, both with finely
granulate oospores (termed FG clade).  Nitella leibergii and two isolates of N.
confervaceae from eastern United States were found nested among these taxa.  Wood
(1965) reported granulate oospores for Nitella leibergii, and SEM revealed N.
confervaceae oospores to be granulate (data not shown).  Nitella confervaceae has also
been reported to be fibrous (John and Moore, 1987); however, the oospores examined in
their study were from a French specimen labeled N. batrachosperma, an illegitimate
name used for samples studied from that region (Hy, 1905; Hy, 1913; Hy, 1914).  Nitella
mucosa (Nordst.) J. Groves, N. penicillata Braun, N. sonderi Braun, and an unidentified
Nitella species from China (Nitella sp. 251), formed a monophyletic group sister to the
119
FG clade.  All species in this clade have granulate to papillate oospores (Leitch et al.,
1990).  It is interesting to note that both N. penicillata and N. sonderi are morphologically
similar dioecious species distinguished by the production of mucus; N. sonderi produces
mucus and N. penicillata does not.  Nitella sp. 251, a monoecious taxon, was found
embedded within three isolates of N. sonderi (Figure IV-5).  Nitella sp. 251, like N.
sonderi, produces mucus, but fertile branchlet segments are somewhat reduced after the
primary branchlet ray, which maintains a length similar to sterile branchlets in culture
(not shown).  LM revealed a granulate oospore surface like other species in this clade, but
oospores from this species should be reexamined under SEM to confirm the surface
ornamentation.
A second clade identified by Sakayama et al. (2004) included species with
reticulate or papillate oospore membrane (RP clade; N. furcata (Roxb. ex Bruz.) Ag., N.
inversa Imah., N. tumulosa Zanev., N. gracillima T.F. Allen, N. axillaris A. Br, and N.
axilliformis Imah.).  A clade including these species was also recovered in the analyses
presented here, but this clade now includes N. megacarpa T. F. Allen, N. polycarpa Pal.,
N. intermedia Nordst. in T. F. Allen, and N. aff. mucronata (Figure IV-5).  The
monophyly of this group was poorly supported with the rbcL data, and additional data
from atpB was required to obtain reasonable support values for the RP clade (Sakayama
et al., 2004).  Nitella megacarpa, N. polycarpa, N. intermedia, were consistent with all
sharing papillate or irregular reticulate oospore surface under LM.  SEM studies of N.
megacarpa and N. intermedia also showed papillate or reticulate ornamentation (C?ceres,
1977; John and Moore, 1987).  Because voucher material was not available for N. aff.
120
mucronata, oospores were not examined and the species determination of this isolate is in
doubt.
A third clade described by Sakayama et al. (2004) was characterized by finely
granulate oospore membrane and strongly flanged ridges (VFG clade).  This clade
included several isolates of Nitella gracilens Morioka (Sakayama et al., 2004).  In this
study, N. subtilissima A. Br. em was found sister to a clade containing N. gracilens and
N. orientalis T. F. Allen (Figure IV-5).  Nitella gracilens, N. orientalis and N.
subtilissima share prominent flanged ridges and the oospore membrane of N. subtilissima
is granulate (Frame, 1977), while N. orientalis has obscurely granulate (Wood, 1965) or
roughened, pitted, or papillate oospore ornamentation (Frame, 1977).  Sister to the VFG
clade was an assemblage of three species with variable oospore morphology, N. partita,
N. verticillata, and Nitella sp. 239 (discussed above).
Six populations of N. tenuissima (Desv.) Kuetz. were sampled.  One from
Indiana, two from Michigan, and three from Wisconsin, and rbcL sequence data for all
populations were found to be identical.  This species formed a distinct lineage near the
base of subgenus Tieffallenia, not closely allied with any other species sampled (Figure
IV-5).  Consistent with its distinct phylogenetic placement, oospores of N. tenuissima are
strongly beaded reticulate (Frame, 1977; John and Moore, 1987), an uncommon
condition among species in this subgenus.
The final clade identified by Sakayama et al. (2004) included N. spiciformis
Morioka and N. moriokae R.D.W. both with tuberculate oospore membrane (TUB clade).
A clade containing these two species along with N. translucens (Pers.) Ag. and N.
mucronata (A. Br.) Miq. was recovered with strong support (Figure IV-5).  Similar to N.
121
spiciformis and N. moriokae, N. translucens and N. mucronata have strongly flanged
oospores, however the oospore surface is described as finely reticulate due to low
anastomosing ridges or surface wrinkles in N. translucens, and strongly reticulate for N.
mucronata (John and Moore, 1987).
Conclusions
Determination of the taxonomy and molecular phylogeny within the genus Nitella
is not altogether a simple problem.  However, results like those presented by Sakayama
and his colleagues (Sakayama et al., 2004; Sakayama et al., 2002), and those presented
here, serve as steps toward untangling the complex evolutionary history of Nitella.  Prior
to the application of contemporary molecular method, charophytologists have
painstakingly tried to reconcile a diverse and morphologically variable group of fresh
water green algae into a clear and natural system.  The molecular results presented here,
combined with previously published data, have resolved a few questions within Nitella
and raised even more.  A basal split in Nitella revealed two clades that correlate with
chromosome number, while single-celled dactyls likely represent a pliesiomorphic
condition not useful in defining deep divergences in this genus.  All taxa with multicelled
dactyls (? 2) studied to date form a strongly supported, natural group.  This group can
further be divided into two lineages, one characterized by 2(-3) celled dactyls
(Tieffallenia) and the other by ? 3 celled dactyls (Hyella).  Most previous authors agreed
with this latter finding, and the proposed exceptions have proven to not be exceptions
after all (e.g., Nitella cristata and N. tasmanica).  Thorough collection of members of
subgenus Hyella promises to reveal considerable unrecorded species diversity.  SEM
122
studies of oospore morphology are remarkably well correlated with the molecular
phylogeny providing synapomorphies for relatively finite groups of Nitella species.
Are multiple representatives of morphologically similar Nitella accessions
different species?  These current data do not allow us to strongly invoke any one existing
species concept to resolve this question.  Application of the biological species concept
(Dobzhansky, 1935; Mayr, 1942) would require reproductive compatibility data that are
not available for Nitella, though several studies exist for Chara (see Chapter I).  Nitella
are generally delicate and difficult to culture.  Crossing experiments would require large
amounts of green house space and sufficient time for completion of their lifecycle.
Though feasible, testing the biological species concept for Nitella can only be seen as
project with a long-term goal of generating adequate reproductive compatibility data.
Application of the phylogenetic species concept (Cracraft, 1989; de Queiroz and
Donoghue, 1990) would require additional molecular markers from multiple accessions
that represent populations of Nitella species.  Collection of multiple Nitella species is
currently under way and sequencing of a complete nuclear genome of Chara braunii is in
progress (as part of the NSF Tree of Life program).  With a completed genome and
multiple isolates of Nitella available, testing the phylogenetic species concept appears
tractable.  This leaves the morphological species concept (Mayr, 1942).  Morphological
variation within Nitella has resulted in a troublesome taxonomic history.  Increased taxon
sampling guided by robust phylogenies offers hope toward understanding this variation
and identifiying key morphological characters useful for understanding this interesting
group of green algae.
123
Appendix I.  Clade names and definitions.  Many of the relationships (clades) presented
for the early branching events in the Charophyta were unresolved prior to this study.  As
a consequence formal names for these clades were unavailable.  Clades were assigned
names loosely following the PhyloCode emphasizing node-based rather than stem-based
names.  Node-based definition was preferred because much of the discussion regarding
these clades revolves around the ancestor more so than the stem lineage.  Contrary to the
PhyloCode, several clades were identified by generic rather than species names either
because species were difficult to identify or DNA sequences were derived from different
species of the same genus.  These names are not meant to be formal assignments, rather a
temporary means of communication in the context of this dissertation.  I strongly feel that
formal names are needed, but further study is necessary.
[Volvox...Chlam] is the least inclusive clade containing Volvox carteri and Chlamydomonas reinhardtii.
[Volvox...Paulsc] is the least inclusive clade containing Volvox carteri and Paulschulzia pseudovolvox.
[Volvox...Pterom] is the least inclusive clade containing Volvox carteri and Pteromonas angulosa.
[Klenit...Klesub] is the least inclusive clade containing Klebsormidium nitens and Klebsormidium subtilissimum.
[Klenit...Klefla] is the least inclusive clade containing Klebsormidium nitens and Klebsormidium flaccidum.
[Klebsormidiales] is the least inclusive clade containing Klebsormidium nitens and Entransia fimbriata.
[Mesota...Mougeo] is the least inclusive clade containing Mesotaenium caldariorum and Mougeotia sp.
[Spirog...Zygnem] is the least inclusive clade containing Spirogyra maxima and Zygnema peliosporum.
[Mesota...Zygnem] is the least inclusive clade containing Mesotaenium caldariorum and Zygnema peliosporum.
[Cosmoc...Onycho] is the least inclusive clade containing Cosmocladium perissum and Onychonema sp.
[Cosmoc...Gonato] is the least inclusive clade containing Cosmocladium perissum and Gonatozygon monotaenium.
[Cirreg...Csiemi] is the least inclusive clade containing Coleochaete irregularis and Coleochaete sieminskiana.
[Corbic...Csolut] is the least inclusive clade containing Coleochaete orbicularis and Coleochaete soluta.
[Lychno...Nitops] is the least inclusive clade containing Lychnothamnus barbatus and Nitellopsis obtusa.
[Lampro...Cconni] is the least inclusive clade containing Lamprothamnium macropogon and Chara connivens.
[Lampro...Caustr] is the least inclusive clade containing Lamprothamnium macropogon and Chara australis.
[Trache...Sphagu] is the least inclusive clade containing tracheophytes and Sphagnum spp.
[Trache...Anthos] is the least inclusive clade containing tracheophytes and Anthoceros.
[Embryo...Charales] is the least inclusive clade containing embryophytes and Charales.
[Embryo...Coleochaetales] is the least inclusive clade containing embryophytes and Coleochaetales.
[Embryo...Zygnematales] is the least inclusive clade containing embryophytes and Zygnematales.
[Embryo...Klebsormidiales] is the least inclusive clade containing embryophytes and Klebsormidiales
[Embryo...Chlorokybales] is the least inclusive clade containing embryophytes and Chlorokybus.
124
Appendix II.  Summary of species and source information for Characeae.  Vouchers for
collections with a numbers preceeded by ?KGK? have been deposited in the University of
Maryland Norton-Brown Herbarium (MARY).  GenBank numbers for previously
published data and locality information for new data is provided when known.
Taxon
collection or
GenBank
number
other strain or
collection numberLocality
Chara
C. australisX-067Outside Sydney, New South Wales, Australia
C. brauniiKGK-0339589Mrs. L's Playa, Lubbock, Texas, USA
C. brittoniiKGK-0196X-997Lawrence Lake, Barry, Michigan, USA
C. connivensAF097161
C. fibrosaKGK-0057aTaihu Lake, Wuxi, Jiangsu, China
C. haitensisTAMPS 80Xicotemcatl, Tamalpais, Mexico
C. vulgarisAF097166X-152Demark
Lamprothamnium
L. heraldiKGK-0069AG-22-10-01-8Lower Bell Lake, New South Wales, Australia
L. macropogonU27534Tasmania, Australia
L. papulosumAF097170France
Lychnothamnus
Ly. barbatusAF097172Poland
Ly. barbatusU27533pond near Bacinska, Jezera, Croatia
Ly. barbatusAF097171Wallace Creek, Queensland, Australia
Nitellopsis
Ni. obtusaU27530Stadtwaldsee, Bremen, Germany
Ni. obtusaKGK-0057eTaihu Lake, Wuxi, Jiangsu, China
Tolypella
T. glomerataAF097176
T. nidificaU27531
T. porteriX-907
T. proliferaAF097175
T. proliferaF142
T. stipitataSue Miers
Nitella
N. acuminataKGK-0052aLong Lake, Iron, Wisconsin, USA
N. acuminataKGK-0346159Arenal Road, Costa Rica
N. acuminataAB110866
N. axillarisKGK-0216152BLake Apanas, Nicaragua
N. axilliformisAB110877Watarase-yusuiti, Tochigi, Japan
N. bastinii773Floyd, Texas, USA
N. clavataKGK-0232X-770 = Peru 3BChincheras #2, near Cuzco, Peru
N. confervaceaKGK-0037cLake Burnt Mills, Isle of Wight, Virginia, USA
125
N. congestaKGK-0354p462Bannister River, Western Australia, Australia
N. cristataKGK-027712/NC/-/BrunnerLake Brunner, South Island, New Zealand
N. cristataKGK-0128p266Barleyfields Lagoon, New South Wales, Australia
N. cristataKGK-0118p259Dumaresq Creek, New South Wales, Australia
N. diffusaKGK-0368p471Ararat, Victoria, Australia
N. flexilisKGK-0392Partin's Mill Pond, Wake, North Carolina, USA
N. furcataAB076059
N. furcataKGK-0038Airfield Lake, Sussex, Virginia, USA
N. gelatiniferaKGK-0270AG-17-2-02-1Cunning River, Western Australia, Australia
N. gracilensAB110870Yokawa-cho, Hyogo, Japan
N. gracilensAB076061Japan
N. gracillimaAB110874Yokawa-cho, Hyogo, Japan
N. hookeriKGK-01212/NH/-/RairaLake Rotoaira, Central North Island, New Zealand
N. hookeriKGK-01212/NH/-/RairaLake Rotoaira, Central North Island, New Zealand
N. hyalinaKGK-0190706Lake Skadarsko, Montenegro, Yugoslavia
N. hyalinaAB076067Japan
N. hyalinaKGK-0227AG-22-10-01-11Wallace Creek, Queensland, Australia
N. hyalinaKGK-0328AG-22-11-01-1Lake Fitzpatrick, Australia
N. hyalinaKGK-0271Nhy/1/-/TaraweraLake Tarawera, North Island, New Zealand
N. hyalinaKGK-0059bY-030Lake Mattamuskeet, Hyde, North Carolina, USA
N. ignescensKGK-0258AG-30-09-01-3Greens Lake, Victoria, Australia
N. ignescensKGK-0258AG-30-09-01-1Lake Cooper, Victoria, Australia
N. inversaAB076060Japan
N. leibergiiKGK-0051Sandy Beach Lake, Iron, Wisconsin, USA
N. leonhardiiKGK-0119Lake Rotoma, North Island, New Zealand
N. leptostachysKGK-0240p299Freshwater Lake, Grampians, Victoria, Australia
N. lhotzkyiKGK-0287p404Caroline Springs, Melbourne, Victoria, Australia
N. macouniiKGK-0156235ABelle Plaine, Saskatchuwon, Canada
N. megacarpaKGK-0052bLong Lake, Iron, Wisconsin, USA
N. megasporaAB110872Watarase-yusuiti, Tochigi, Japan
N. microcephalaKGK-0351p467Piney Lake, Western Australia, Australia
N. mirabilisAB110865Bog at Yokawa-cho, Hyogo, Japan
N. misouriensisX-867New Mexico, USA
N. moriokaeAB110876Yokawa-cho, Hyogo, Japan
N. mucosaKGK-0275NP/1/-/OkatainaLake Okataina, North Island, New Zealand
N. mucronataF109France
N. mucronataKGK-0189705Lake Skadarsko, Montenegro, Yugoslavia
N. aff. MucronataP/CR1Panama/Costa Rica
N. opacaAF097174F146
N. opacaKGK-0276NF/1/-/TaraweraLake Tarawera, North Island, New Zealand
N. orientalisKGK-0291p378Murray River, South Australia, Australia
N. partitaKGK-0176p279Pied Stilt Swamp, New South Wales, Australia
N. penicillataKGK-0174p281Olympic wetland, Victoria, Australia
N. polycarpaKGK-0230150BLake Apanas, pearched pond, , Nicaragua
N. praelongaKGK-0390Lake Okeechobee, Florida, USA
N. pseudoflabellataAB076065Japan
N. pseudoflabellataAB076066Japan
N. pulchellaAB076057Japan
N. sonderiKGK-0292p379Murray River, South Australia, Australia
126
N. sonderiKGK-0251AG-13-01-02-2Paddy's River, New South Wales, Australia
N. sp.KGK-0245p296Interlaken, Tasmania, Australia
N. sp.KGK-0175p280Halls Gap, Grampians, Victoria, Australia
N. sp.KGK-0115p256Native Dog Creek, New South Wales, Australia
N. sp.KGK-0352p465Margaret River, Western Australia, Australia
N. sp.KGK-0353P464Bootjidup River, Western Australia, Australia
N. sp.KGK-0239p298Freshwater Lake, Grampians, Victoria, Australia
N. sp.KGK-0295Lake Habeeb , Allegany, Maryland, USA
N. sp.KGK-0057gTaihu Lake, Wuxi, Jiangsu, China
N. spiciformisAB110875Watarase-yusuiti, Japan
N. stuartiiKGK-0273NS/1/-/AchesonAcheson Stream, North Island, New Zealand
N. stuartiiKGK-0382AG-30-12-02-2-3Molonglo River, New South Wales, Australia
N. stuartiiF155bF155Dumaresq Creek, New South wales, Australia
N. subtilissimaKGK-0082p231Lanark, Hamilton, Victoria, Australia
N. aff. tasmanicaF156F154Barleyfields Lagoon, New South Wales, Australia
N. aff. tasmanicaKGK-0355p466Mt. Barker, Western Australia, Australia
N. aff. tasmanicaKGK-0078AG04Paddy's River, New South Wales, Australia
N. tenuissimaKGK-0049bLake Tomohawk, Oneida, Wisconsin, USA
N. translucensAF097745F108France
N. tricellularisKGK-018614/NH/T/LyndonLake Lyndon, South Island, New Zealand
N. tumulosaAB110868Haew Loam waterfall, Thailand
N. ungulaKGK-0173p282Lake Bolac, Victoria, Australia
N. verticillataKGK-0113p254Brixton St NR, Western Australia, Australia
127
References
Allen, G. O. 1954. An annotated key to the Nitelleae of North America. Bulletin of the
Torrey Botanical Club 81:35-60.
Allen, T. F. 1888. Nitella (not Tolypella) Macounii. Bulletin of the Torrey Botanical Club
15:11.
Arnason, U., A. Gullberg, and A. Janke. 1998. Molecular timing of primate divergences
as estimated by two nonprimate calibration points. JOURNAL OF MOlecular
Evolution 47:718-27.
Ayala, F. J. 1997. Vagaries of the molecular clock. Proceedings of the NATional
Academy of Sciences OF the United States of America 94:7776-83.
Banerji, J. 2000. Megaflora diversity of the upper Gondwana sequence of the Rajmahal
Basin, India. Journal of African Earth Sciences 31:133-144.
Bauhin, C. 1623. Pinax theatri botanici... Basileae Helvet.
Beckert, S., S. Steinhauser, H. Muhle, and V. Knoop. 1999. A molecular phylogeny of
bryophytes based on nucleotide sequences of the mitochondrial nad5 gene. Plant
Syst. Evol. 218:179-192.
Bell, W. A. 1922. A new genus of Characeae and new Merostomata from Coal Measures
of Nova Scotia. Transactions of the Royal Society of Canada ser. 3:159-167.
Bhattacharya, D., K. Weber, S. S. An, and W. Berning-Koch. 1998. Actin phylogeny
identifies Mesostigma viride as a flagellate ancestor of the land plants. Journal of
Molecular Evolution 47:544-50.
Blindow, I. 1992. Long- and short-term dynamics of submerged macrophytes in two
128
shallow eutrophic lakes. Freshwater Biology 28:15-27.
Bollback, J. P. 2001. CodonBootstrap, version v3.0b4. Distributed by the author.
Department of Biology, University of Rochester.
Bower, F. O. 1908. The origin of land flora. A theory based upon the facts of alternation.
Macmillian and Co., London.
Braun, A., and C. F. O. Nordstedt. 1882. Fragmente einer Monographie der Characeen.
Abh. K. Akad. Wiss., Berlin.
Britten, R. J. 1986. Rates of DNA sequence evolution differ between taxonomic groups.
Science 231:1393-8.
Butterfield, N. J., A. H. Knoll, and K. Swett. 1988. Exceptional preservation of fossils in
an Upper Proterozoic shale. Nature 334:424-7.
Butterfield, N. J., A. H. Knoll, and K. Swett. 1990. A bangiophyte red alga from the
Proterozoic of arctic Canada. Science 250:104-7.
C?ceres, E. J. 1975. Novedades car?logicas argentinas I. Una nueva especie de Nitella y
tres adiciones al g?nero para la flora Argentina. Kurtziana 8:105-125.
C?ceres, E. J. 1977. Percisiones sombre la ornamentaci?n de la o?spore de Nitella
megacarpa. Kurtziana 10:250-251.
Casanova, M. T. 1991. An SEM study of developmental variation in oospore wall
ornamentation of three Nitella species (Charophyta) in Australia. Phycologia
30:237-242.
Chapman, R. L., and M. A. Buchheim. 1991. Ribosomal RNA gene sequences: analysis
and significance in the phylogeny and taxonomy of green algae. Critical Reviews
in Plant Sciences 10:343-368.
129
Chapman, R. L., M. A. Buchheim, C. F. Delwiche, T. Friedl, V. A. R. Huss, K. G. Karol,
L. A. Lewis, J. Manhart, R. M. McCourt, J. L. Olsen, and D. A. Waters. 1998.
Molecular Systematics of the Green Algae. Pages 508-540 in Systematics of
Plants II (D. E. Soltis, P. S. Soltis, and J. J. Doyle, eds.). Kluwer Academic
Publishers, Norwell.
Choquette, G. B. 1956. A new Devonian charophyte. Journal of Paleontology 30:1371-
1374.
Cimino, M. T., and C. F. Delwiche. 2002. Molecular and morphological data identify a
cryptic species complex in endophytic members of the genus Coleochaete Breb.
(Charophyta: Coleochaetaceae). Journal of Phycology 38:1213-1221.
Cook, M. E., and L. E. Graham. 1998. Structural similarities between surface layers of
selected charophycean algae and bryophytes and the cuticles of vascular plants.
International Journal of Plant Sciences 159:780-787.
Cook, M. E., L. E. Graham, C. E. J. Botha, and C. A. Lavin. 1997. Comparative
ultrastructure of plasmodesmata of Chara and selected bryophytes: Toward an
elucidation of the evolutionary origin of plant plasmodesmata. American Journal
of Botany 84:1169-1178.
Cook, M. E., L. E. Graham, and C. A. Lavin. 1998. Cytokinesis and nodal anatomy in the
charophycean green alga Chara zeylanica. Protoplasma 203:65-74.
Cooper, A., and D. Penny. 1997. Mass survival of birds across the Cretaceous-Tertiary
boundary: molecular evidence. Science 275:1109-1113.
Corillion, R. 1957. Les Charophyc?es de France et d'Europe Occidentale. Bulletin de la
Soci?t? Scientifique de Bretagne 32:1-256.
130
Cracraft, J. 1989. Speciation and its ontogeny: the empirical consequences of alternative
species concepts for understanding patterns and processes of differentiation.
Pages 25-59 in Speciation and its consequences (D. Otte, and J. A. Endler, eds.).
Sinauer Associates, Suderland, MA.
Crawford, S. A. 1977. Chemical, physical and biological changes associated with Chara
succession. Hydrobiologia 55:209-217.
Croft, W. N. 1952. A new Trochiliscus (Charophyta) from the Downtonian of Podolia.
Bulletin of the British Museum (Natural History) Geology 1:189-220.
Crum, G. H. 1975. Distribution, taxonomy, and ecology of Charophytes in IowaIowa
State University, Ames.
Daily, F. K. 1969. Some late glacial charophytes compared to modern species.
Proceedings of the Indiana Academy of Sciences 78:406-412.
Dale, H. M. 1986. Temperature and light: the determining factors in maximum depth
distribution of aquatic macrophytes in Ontario, Canada. Hydrobiologia 133:73-77.
Darwin, C. 1859. On the Origin of Species. J. Murray, London.
De Jesus, M. D., F. Tabatabai, and D. J. Chapman. 1989. Taxonomic distribution of
copper-zinc superoxide dismutase in green algae and it phylogenetic importance.
Journal of Phycology 25:767-772.
de Queiroz, A., and M. J. Donoghue. 1990. Phylogenetic systematics or Nelson's version
of cladistics. Cladistics 6:61-75.
de Winton, M. D., J. S. Clayton, R. D. S. Wells, C. C. Tanner, and S. T. Miller. 1991.
Submerged vegetation of lakes summer, Marion, Katrine, Taylor, and Sheppard in
Canterbury, New Zealand. New Zealand Journal of Marine and Freshwater
131
Research 25:145-151.
Delwiche, C. F., L. E. Graham, and N. Thomson. 1989. Lignin-like compounds and
sporopollenin in Coleochaete, an algal model for land plant ancestry. Science
245:399-401.
Delwiche, C. F., K. G. Karol, M. T. Cimino, and K. J. Sytsma. 2002. Phylogeny of the
genus Coleochaete (Charophyceae, Chlorophyta) and related taxa inferred by
analysis of the chloroplast gene rbcL. Journal of Phycology 38:394-403.
Delwiche, C. F., M. Kuhsel, and J. D. Palmer. 1995. Phylogenetic analysis of tufA
sequences indicates a cyanobacterial origin of all plastids. Molecular
Phylogenetics and Evolution 4:110-128.
Dobzhansky, T. 1935. A critique of the species concept in biology. Philos. Soc. 2:344-
355.
Domozych, D. S., K. D. Stewart, and K. R. Mattox. 1980. The comparative aspects of
cell wall chemistry in the green algae. J. Mol. Evol. 15:1-12.
Doyle, J. A., and M. J. Donoghue. 1993. Phylogenies and angiosperm diversification.
Paleobiology 19:141-167.
Doyle, J. J., and J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities
of fresh leaf tissue. Phytochemical Bulletin 19:11-15.
Duncan, T. M., K. S. Renzaglia, and D. J. Garbary. 1997. Ultrastructure and phylogeny
of the spermatozoid of Chara vulgaris (Charophyceae). Plant Systematics and
Evolution 204:125-140.
Edwards, D. S., and A. G. Lyon. 1983. Algae from the Rhynie Chert. Botanical Journal
of the Linnean Society 86:37-55.
132
Feist, M., and R. Feist. 1997. Oldest record of a bisexual plant. Nature 385:401.
Feist, M., and N. Grambast-Fessard. 1982. Cl? de d?termination pour les genres de
Charophytes. Pal?obiologie Continentale 13:1-28.
Feist, M., and N. Grambast-Fessard. 1991. The genus concept in Charophyta: evidence
from Palaeozoic to recent. Pages 189-203 in Calcareous Algae and Stromatolites
(R. Riding, ed.) Springer-Verlag, Berlin.
Felsenstein, J. 1978. Cases in which parsimony or compatibility methods will be
positively misleading. Syst. Zool. 27:401-410.
Felsenstein, J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood
approach. Journal of Molecular Evolution 17:368-376.
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap.
Evolution 39:783-791.
Filarszky, N. 1937. Idengenf?ldi Charaf?l?k hat?roz?da (Determinatio Characearum
exoticarum). Magyar Tudom?ny Akad?mia Term ?rtekez?sek 55:476-497.
Fitch, W. M. 1971. Toward defining the course of evolution: Minimum change for a
specific tree topology. Systematic Zoology 20:406-416.
Fitch, W. M. 1976. Molecular evolutionary clocks. Pages 160-178 in Molecular
Evolution (F. J. Ayala, ed.) Sinauer, Sunderland, Massachusetts, USA.
Frame, P. 1977. Fine structural studies of oospore ornamentation and bulbil development
in charophytes. Pages 182 University of Toronto, Toronto.
Frederick, S. E., P. J. Gruber, and N. E. Tolbert. 1973. The occurrence of glycolate
dehydrogenase and glycolate oxidase in green plants. Plant Physiology 52:318-
323.
133
Friedl, T. 1997. The evolution of the green algae. Pages 87-101 in The Origin of Algae
and their Plastids (D. Bhattacharya, ed.) Springer-Verlag, Wien New York.
Fritsch, F. E. 1935. The Structure and the Reproduction of the Algae, Cambridge.
Garc?a, A. 1998. Nitella ignescens sp. nov. and N. ungula sp. nov. (Charales, Charophyta)
from Australia. Phycologia 37:53-59.
GCG. 2000. Wisconsin Package, version 10.0. Genetics Computer Group.
Gillespie, J. H. 1991. The Causes of Molecular Evolution. Oxford University Press,
Oxford.
Gillet, C. 1959. Nombres chromosomiques de plusieurs esp?ces de Charophyc?es (genres
Nitella et Chara). Revue de la Cytologie et de la Biologie V?g?tale 20:229-234.
Gissi, C., A. Reyes, G. Pesole, and C. Saccone. 2000. Lineage-specific evolutionary rate
in mammalian mtDNA. Molecular Biology and Evolution 17:1022-31.
Glazko, G. V., and M. Nei. 2003. Estimation of divergence times for major lineages of
primate species. Molecular Biology and Evolution 20:424-434.
Goldman, N. 1993. Statistical tests of models of DNA substitution. Journal of Molecular
Evolution 36:182-198.
Gontcharov, A. A., B. Marin, and M. Melkonian. 2003. Molecular phylogeny of
conjugating green algae (Zygnemophyceae, Streptophyta) inferred from SSU
rDNA sequence comparisons. Journal of Molecular Evolution 56:89-104.
Goremykin, V. V., S. Hansmann, and M. W. F. 1997. Evolutionary analysis of 58
proteins encoded in six completely sequenced chloroplast genomes: revised
molecular estimates of two seed plant divergence times. Plant Systematics and
Evolution 206:337-351.
134
Graham, L. E. 1993. The Origin of Land Plants. John Wiley, New York.
Graham, L. E. 1996. Green algae to land plants: an evolutionary transition. Journal of
Plant Research 109:241-251.
Graham, L. E., C. F. Delwiche, and B. D. Mishler. 1991. Phylogenetic connections
between the 'green algae' and the 'bryophytes'. Adv. Bryol. 4:213-244.
Graham, L. E., and L. W. Wilcox. 2000. The Algae. Prentice Hall, Upper Saddle River,
NJ.
Graham, S. W., and R. G. Olmstead. 2000. Utility of 17 chloroplast genes for inferring
the phylogeny of the basal angiosperms. American Journal of Botany 87:1712-
1730.
Grambast, L. J. 1956. La Plaque basal des Charac?es. CR Acad. Sci. Paris Ser D
242:2585-2587.
Grambast, L. J. 1974. Phylogeny of the Charophyta. Taxon 43:463-481.
Grey, J. 1993. Major Paleozoic land plant evolutionary bio-events. Palaeogeography,
Palaeoclimatology, Palaeoecology 104:153-169.
Grey, J., D. Massa, and A. J. Boucot. 1982. Caradocian land plant microfossils from
Libia. Geology 10:197-201.
Groves, J. 1933. Charophyta. Pages 1-74 in Fossilium Catalogus (W. Jongmans, ed.),
Berlin.
Groves, J., and G. R. Bullock-Webster. 1920. The British Charophyta, I. Nitelleae. Ray
Society, London.
Groves, J., and G. R. Bullock-Webster. 1924. The British Charophyta, II. Chareae. Ray
Society, London.
135
Guerlesquin, M. 1967. Recherches caryotypiques et cytotaxinomiques chez les
Charophyc?es d'Europe occidentale et d'Afrique du Nord. Jouve, Paris.
Guerlesquin, M. 1991. Preliminary study of the Characeae species in high-altitude lakes
in western Europe, Morocco, and Bolivia. Journal of Phycology 27:26.
Halsted, B. D. 1879. Classification and description of the American species of Characeae.
Proceedings of the Boston Society of Natural History 20:169-190.
Hasegawa, M., H. Kishino, and T. Yano. 1985. Dating the human-ape split by a
molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22:160-
174.
Hasegawa, M., H. Kishino, and T. Yano. 1989. Estimation of branching dates among
primates by molecular clocks of nuclear DNA which slowed down in
Hominoidea. Journal of Human Evolution 18:461-476.
Heckman, D. S., D. M. Geiser, B. R. Eidell, R. L. Stauffer, N. L. Kardos, and S. B.
Hedges. 2001. Molecular evidence for the early colonization of land by fungi and
plants. Science 293:1129-1133.
Hedges, S. B., P. H. Parker, C. G. Sibley, and S. Kumar. 1996. Continental breakup and
the diversification of birds and mammals. Nature 381:226-229.
Hemsley, A. R. 1989. The ultrastructure of the spores of the Devonian plant Parka
decipiens. Annals of Botany 64:359-367.
Hemsley, A. R. 1990. Parka decipiens and land plant spore evolution. Historical Biology
4:39-50.
Hillis, D. M., J. P. Huelsenbeck, and C. W. Cunningham. 1994. Application and accuracy
of molecular phylogenies. Science 264:671-677.
136
Hillis, D. M., B. K. Mable, and C. Moritz. 1996. Applications of Molecular Systematics.
Pages 515-543 in Molecular Systematics (D. M. Hillis, C. Moritz, and B. K.
Mable, eds.). Sinauer, Sunderland.
Horn af Rantzien, H. 1951. On the fossil Charophyta of Latin America. Sv. Bot. Tidskr.
45:658-677.
Horn af Rantzien, H. 1957. Nitellaceous Charophyte gyrogonites in the Rajmahal series
(Upper Gondwana) of India. Acta Universitatis Stockholmiensis, Stockholm
Contributions in Geology 1:1-29.
Horn af Rantzien, H. 1959. Recent charophyte fruitifications and their relations to fossil
charophyte gyrogonites. Kungliga Svenska Vetenskapsakademien Arkiv f?r
Botanik Ser. 2, 4:165-332, pl. 1-19.
Hotchkiss, A. T. 1958. Some chromosome numbers in Kentucky Characeae. Transactions
of the Kentucky Academy of Sciences 19:14-18.
Hotchkiss, A. T. 1963. A first report of chromosome numbers in the genus
Lychnothmanus (Rupr.) Leonh. and comparisons with the other charophyte
genera. Proceedings of the Linnean Society of New South Wales 88:368-372.
Hotchkiss, A. T. 1965. Chromosome numbers in Characeae from the South Pacific.
Pacific Science 19:31-37.
Hotchkiss Jr., A. T., and R. M. Brown Jr. 1987. The association of rosette and globular
terminal complexes with cullulose microfibril assembly in Nitella translucens var.
axillaris (Charophyceae). J. Phycol. 22:229-237.
Huelsenbeck, J. P., and J. P. Bollback. 2001. Application of the likelihood function in
phylogeneticsin Handbook of Statistical Genetics (M. Bishop, ed.) John Wiley &
137
Sons, Ltd., London.
Huelsenbeck, J. P., and F. Ronquist. 2001. MrBayes: Bayesian inference of phylogenetic
trees. Bioinformatics 17:754-755.
Huelsenbeck, J. P., F. Ronquist, R. Nielsen, and J. P. Bollback. 2001. Bayesian inference
of phylogeny: Reverend Bayes meets Darwin. Science 294:2310-2314.
Hutchinson, G. E. 1975. The Lower Rooted Vegetation.in A Treatise on Limnology. J.
Wiley and Sons, New York.
Hy, F. 1905. Sur le Nitella confervacea Braun. Bull. Soc. Bot. Fr. 52:88-94.
Hy, F. 1913. Les Charac?es de France. Bull. Bot. Fr. M?m. 26:1-47.
Hy, F. 1914. Les Charac?es de France. Note additionnelle. Bull. Soc. Bot. Fr. 61:235-
241.
Imahori, K. 1954. Ecology, phytogeography and taxonomy of the Japanese Charophyta.
Kanazawa University Press. Reprinted 1977, Otto Koeltz Science Publishers,
Kownigstein, Germany.
Imahori, K., and M. Kato. 1961. Notes on chromosome numbers of charophytes in Fukui
Prefecture, Japan (I). Pages 39-48 College of General Education, Osaka
University, Japan.
Ishchenko, T. A., and A. A. Ishchenko. 1982. Novaia nakhodka kharophitov v verkhniem
silure Podolii. Pages 21-32 in Sist?matika i ?volutsia drevnik rastenii Ukraini,
Kiev.
Jacobshagen, S., and C. Schnarrenberger. 1990. Two class I aldolases in Klebsormidium
flaccidum (Charophyceae): an evolutionary link from chlorophytes to higher
plants. Journal of Phycology 26:312-317.
138
John, D. M., and J. A. Moore. 1987. An SEM study of the oospore of some Nitella
species (Charales, Chlorophyta ) with descriptions of wall ornamentation and an
assessment of its taxonomic importance. Phycologia 26:334-355.
Keiner, W. 1944. Notes on the distribution and bio-ecology of Characeae in Nebraska.
Butler University Botanical Studies. 6:131-148.
Kenrick, P., and P. R. Crane. 1997a. The Origin and Early Diversification of Land Plants:
a Cladistic Study. Smithsonian Institution Press, Washington.
Kenrick, P., and P. R. Crane. 1997b. The origin and early evolution of plants on land.
Nature 389:33-39.
Kishino, H., and M. Hasegawa. 1989. Evaluation of the maximum likelihood estimate of
the evolutionary tree topologies from DNA sequence data, and the branching
order in Hominoidea. Journal of Molecular Evolution 29:170-179.
Kishino, H., J. L. Thorne, and W. J. Bruno. 2001. Performance of a divergence time
estimation method under a probabilistic model of rate evolution. Molecular
Biology and Evolution 18:352-361.
Knoll, A. H. 1992. The early evolution of Eukaryotes: a geological perspective. Science
256:622-627.
Knoll, A. H. 1996. Archean and Proterozoic paleontology. Pages 51-80 in Palynology:
Principles and Applications (J. Jansonius, and D. C. McGregor, eds.). American
Association of Stratigraphic Palynologists Foundation, Tulsa.
Kodner, R. B., and L. E. Graham. 2001. High-temperature, acid-hydrolyzed remains of
Polytrichum (Musci, Polytrichaceae) resemble enigmatic Silurian-Devonian
tubular microfossils. American Journal of Botany 88:462-466.
139
Kooistra, W. H., and L. K. Medlin. 1996. Evolution of the diatoms (Bacillariophyta). IV.
A reconstruction of their age from small subunit rRNA coding regions and the
fossil record. Molecular Phylogenetics and Evolution 6:391-407.
Krassavina, L. C. 1971. A comparitive study of recent and fossil Charophyta of the
fruitifications in Nitellopsis obtusa and of the gyrogonites in the species of
Tectochara [in Russian]. Acad. Sci. URSS, Instit. Bot. 56.
Kroken, S. B., L. E. Graham, and M. E. Cook. 1996. Occurrence and evolutionary
significance of resistant cell walls in charophytes and bryophytes. American
Journal of Botany 83:1241-1254.
Larget, B., and D. L. Simon. 1999. Markov Chain Monte Carlo algorithms for the
Bayesian analysis of phylogenetic trees. Molecular Biology and Evolution
16:750-759.
Leitch, A. R., D. M. John, and J. A. Moore. 1990. The oosporangium of the Characeae
(Chlorophyta, Charales). Pages 213-268 in Progress in Phycological Research (F.
E. Round, and D. J. Chapman, eds.). Biopress LTD, Bristol.
Lemieux, C., C. Otis, and M. Turmel. 2000. Ancestral chloroplast genome in Mesostigma
viride reveals an early branch of green plant evolution. Nature 403:649-652.
Li, W. H., and M. Tanimura. 1987. The molecular clock runs more slowly in man than in
apes and monkeys. Nature 326:93-6.
Linnaeus, C. 1753. Species Plantarum, exhibentes plantas rite cognitas, ad genera relatas,
cum differentiis specificis, nominibus trivialibus., Holmiae.
Liu, J., and Z. Chen. 1992. Discovery of fossil Charophytes from the Late Triassic
Xujiahe formation and Early Jurassic Lower Yimen formation, Sichuan province,
140
and its significance. Acta Geologica Sinica 66:73-81.
Maddison, D. R., and W. P. Maddison. 2001. MacClade: Analysis of phylogeny and
character evolution, version 4.01. Sinauer Associates.
Mandal, D. K., and S. Ray. 1999. Taxonomic significance of scanning electron
microscopic study of oospore wall ornamentations in Charophyceae.
Phytomorphology 49:425-432.
Mandal, D. K., S. Ray, and A. Mukherjee. 1995. Scanning electron microscopic study of
oospore wall ornamentations in some taxa under Nitella furcata complex
(Charophyta) from India. Phytomorphology 45:39-45.
Manhart, J. R. 1994. Phylogenetic analysis of green plant rbcL sequences. Molecular
Phylogenetics and Evolution 3:114-127.
Manhart, J. R., and J. D. Palmer. 1990. The gain of two chloroplast transfer RNA introns
marks the green algal ancestors of land plants. Nature 345:268-270.
Mann, H., and M. V. S. Raju. 2002. First report of the rare charophyte Nitella macounii
(T. F. Allen) T. F. Allen in Saskatchewan and Western Canada. Canadian Field
Naturalist 116:559-570.
Marin, B., and M. Melkonian. 1999. Mesostigmatophyceae, a new class of streptophyte
green algae revealed by SSU rRNA sequence comparisons. Protist 150:399-417.
Martin, W., D. Lydiate, H. Brinkmann, G. Forkmann, H. Saedler, and R. Cerff. 1993.
Molecular phylogenies in angiosperm evolution. Molecular Biology and
Evolution 10:140-62.
Mart?n-Closas, C. 1999. Epiphytic overgrowth of charophyte thalli by styromatolite-like
structures and fungi in the Lower Cretaceous of the Iberian Ranges (Spain).
141
Australian Journal of Botany 47:305-313.
Mart?n-Closas, C., and C. Di?guez. 1998. Charophytes from the Lower Cretaceous of the
Iberian Ranges (Spain). Paleontology 41:1133-1152.
Mattox, K. R., and K. D. Stewart. 1984. The classification of the green algae: a concept
based on comparative cytology. Pages 29-72 in The Systematics of the Green
Algae (D. E. G. Irvine, and D. M. John, eds.). Academic Press, London and
Orlando.
Mayr, E. 1942. Systematics and the origin of species. Columbia University Press, New
York.
McCourt, R. M. 1995. Green algal phylogeny. Trends in Ecology and Evolution 10:159-
163.
McCourt, R. M., K. G. Karol, J. Bell, K. M. Helm-Bychowski, A. Grajewska, M. F.
Wojciechowski, and R. W. Hoshaw. 2000. Phylogeny of the conjugating green
algae (Zygnemophyceae) based on rbcL sequences. Journal of Phycology 36:747-
758.
McCourt, R. M., K. G. Karol, M. T. Casanova, and M. Feist. 1999. Monophyly of genera
and species of Characeae based on rbcL sequences, with special reference to
Australian and European Lychnothamnus barbatus (Characeae : Charophyceae).
Australian Journal of Botany 47:361-369.
McCourt, R. M., K. G. Karol, M. Feist, C. F. Delwiche, and V. W. Proctor. in prep.
Phylogeny of Chara based on rbcL sequences: tests of the Wood and Proctor
classifications.
McCourt, R. M., K. G. Karol, M. Guerlesquin, and M. Feist. 1996a. Phylogeny of extant
142
genera in the family Characeae (Charales, Charophyceae) based on rbcL
sequences and morphology. American Journal of Botany 83:125-131.
McCourt, R. M., S. T. Meiers, K. G. Karol, and R. L. Chapman. 1996b. Molecular
Systematics of the Charales. Pages 323-336 in Cytology, Genetics and Molecular
Biology of the algae (B. R. Chaudhary, and S. B. Agrawal, eds.). SPB Academic
Publishing., Amsterdam.
McCracken, M. D., V. W. Proctor, and A. T. Hotchkiss. 1966. Attempted hybridization
between monoecious and dioecious clones of Chara. American Journal of Botany
53:937-940.
Meiers, S. T., V. W. Proctor, and R. L. Chapman. 1999. Phylogeny and biogeography of
Chara (Charophyta) inferred from 18S rDNA sequences. Australian Journal of
Botany 47:347-360.
Meiers, S. T., W. L. Rootes, V. W. Proctor, and R. L. Chapman. 1997. Phylogeny of the
Characeae (Charophyta) inferred from organisimal and molecular characters.
Arch. Protistenkd. 148:308-317.
Melkonian, M. 1989. Flagellar apparatus ultrastructure in Mesostigma viride
(Prasinophyceae). Plant Systematics and Evolution 164:93-122.
Mishler, B. C., L. A. Lewis, M. A. Buchheim, K. S. Renzaglia, D. J. Garbary, C. F.
Delwiche, F. W. Zechman, T. S. Kantz, and R. L. Chapman. 1994. Phylogenetic
relationships of the "green algae" and "bryophytes". Annals of the Missouri
Botanical Garden 81:451-483.
Morgan, D. R., and D. E. Soltis. 1993. Phylogenetic relationships among members of
Saxifragaceae sensu lato based on rbcL sequence data. Annals of the Missouri
143
Botanical Garden 80:631-660.
Mukherjee, A., and S. Ray. 1993. Scanning electron microscopic study of compound
oospore wall ornamentations of some charophyte taxa from West Bengal.
Phytomorphology 43:111-116.
Niklas, K. J. 1976. Morphology and ontogenetic reconstruction of Parka decipiens
Fleming and Parchytheca Hooker from the Lower Old Red Sandstone, Scotland.
Transactions of the Royal Society of Edinburgh 69:483-499.
Noordhuis, R., D. T. van der Molen, and M. S. van den Berg. 2002. Response of
herbivorous water-birds to the return of Chara in Lake Veluwemeer, The
Netherlands. Aquatic Botany 72:349-367.
Nordstedt, C. F. O. 1891. Australasian Characeae, described and figured, Lund.
Nozaki, H., M. Kodo, K. Miyaji, M. Kato, M. M. Watanabe, and H. Kasaki. 1998.
Observations on the morphology and oospore wall ornamentation in culture of the
rediscovered Japanese endemic Nitella gracilens (Charales, Chlorophyta).
European Journal of Phycology 33:357.
Okuda, K., and R. M. Brown Jr. 1992. A new putative cellulose-synthesizing complex of
Coleochaete scutata. Protoplasma 168:51-63.
Olsen, S. 1944. Danish Charophyta: Chorological, ecological and biological
investigations. Kongelige Danske Videnskabernes Selskab, Biologiske Skrifter
3:1-240.
Pal, B. P. 1932. Burmese Charophyta. Linnean Journal, Botany 49:47-92.
Peck, R. E. 1953. Fossil charophytes. Botanical Review 19:209-227.
Pickett-Heaps, J. D. 1975. Green Algae. Structure, Reproduction, and Evolution of
144
Selected Genera. Sinauer Associates, Sunderland, MA.
Pickett-Heaps, J. D., and H. J. Marchant. 1972. The phylogeny of the green algae: a new
proposal. Cytobios 6:255-264.
Plinius, S. C. 1469. Historiae Naturalis libri, Venetiis.
Posada, D., and K. A. Crandall. 1998. Modeltest v3.06: testing the model of DNA
substitution. Bioinformatics 14:817-818.
Proctor, V. W. 1970. Taxonomy of Chara braunii: an experimental approach. Journal of
Phycology 6:317-321.
Proctor, V. W. 1971. Chara globularis Thuillier (= C. fragilis Desvaux): Breeding
patterns within a cosmopolitan complex. Limnology and Oceanography 16:422-
436.
Proctor, V. W. 1972. Taxonomic significance of monoecism and dioecism in the genus
Chara. Phycologia 10:299-307.
Proctor, V. W. 1975. The nature of Charophyte species. Phycologia 14:97-113.
Proctor, V. W. 1980. Historical biogeography of Chara (Charophyta): An appraisal of the
Braun-Wood classification plus a falsifiable alternative for future consideration.
Journal of Phycology 16:218-233.
Proctor, V. W. 1990. Characeae of Llano Estacado (Texas and adjacent New Mexico)
playas. Journal of Biogeography 17:75-84.
Proctor, V. W., D. G. Griffin III, and A. T. Hotchkiss. 1971. A synopsis of the genus
Chara, Series Gymnobasalia (Subsection Willdenowia RDW). American Journal
of Botany 58:894-901.
Proctor, V. W., and F. H. Wiman. 1971. An experimental approach to the systematics of
145
the monoecious-conjoined members of the genus Chara, Series Gymnobasalia.
American Journal of Botany 58:885-893.
Pryer, K. M., H. Schneider, A. R. Smith, R. Cranfill, P. G. Wolf, J. S. Hunt, and S. D.
Sipes. 2001. Horsetails and ferns are a monophyletic group and the closest living
relatives to seed plants. Nature 409:618-622.
Qiu, Y.-L., Y. Cho, J. C. Cox, and J. D. Palmer. 1998. The gain of three mitochondrial
introns identifies liverworts as the earliest land plants. Nature 394:671-674.
Qiu, Y.-L., J. Lee, F. Bernasconi-Quadroni, D. E. Soltis, P. S. Soltis, M. Zanis, E. A.
Zimmer, Z. Chen, V. Savolainen, and M. W. Chase. 1999. The earliest
angiosperms: Evidence from mitochondrial, plastid and nuclear genomes
[published erratum appears in Nature 2000 May 4;405(6782):101]. Nature
402:404-407.
Qiu, Y.-L., J. Lee, B. A. Whitlock, F. Bernasconi-Quadroni, and O. Dombrovska. 2001.
Was the ANITA rooting of the angiosperm phylogeny affected by long-branch
attraction? Molecular Biology and Evolution 18:1745-1753.
Rannala, B., J. P. Huelsenbeck, Z. Yang, and R. Nielsen. 1998. Taxon sampling and the
accuracy of large phylogenies. Syst. Biol. 47:702-710.
Rannala, B., and Z. Yang. 1996. Probability distribution of molecular evolutionary trees:
A new method of phylogenetic inference. Journal of Molecular Evolution 43:304-
11.
Ray, S., S. Pekkari, and P. Snoeijs. 2001. Oospore dimentions and wall ornamentation
patterns in Swedish charophytes. Nordic Journal of Botany 21:207-224.
Robinson, C. B. 1906. The Characeae of North America. Bulletin of the New York
146
Botanical Garden. 4:244-308.
Rogers, C. E., D. S. Domozych, K. D. Stewart, and K. R. Mattox. 1981. The flagellar
apparatus of Mesostigma viride (Prasinophyceae): Multilayered structures in a
scaly green flagellate. Plant Systematics and Evolution 138:247-258.
Round, F. E. 1981. The Ecology of Algae. Cambridge University Press, Cambridge.
Russo, C. A., N. Takezaki, and M. Nei. 1995. Molecular phylogeny and divergence times
of drosophilid species. Molecular Biology and Evolution 12:391-404.
Sakayama, H., Y. Hara, and H. Nozaki. 2004. Taxonomic re-examination of six species
of Nitella (Charales, Charophyceae) from Asia, and phylogenetic relationships
within the genus based on rbcL and atpB gene sequences. Phycologia 41:91-104.
Sakayama, H., H. Nozaki, H. Kasaki, and Y. Hara. 2002. Taxonomic re-examination of
Nitella (Charales, Charophyceae) from Japan, based on microscopical studies of
oospore wall ornamentation and rbcL gene sequences. Phycologia 41:397-408.
Sanders, E. R., K. G. Karol, and R. M. McCourt. 2003. Occurrence of matK in a trnK
group II intron in charophyte green algae and phylogeny of the Characeae.
American Journal of Botany 90:628-633.
Sanderson, M. J. 1997. A nonparametric approach to estimating divergence times in the
absence of rate constancy. Molecular Biology and Evolution 14:1218-1231.
Sanderson, M. J. 2003. Molecular data from 27 proteins do not support a Precambrian
origin of land plants. American Journal of Botany 90:954-956.
Sanderson, M. J., and J. A. Doyle. 2001. Sources of error and confidence intervals in
estimating the age of angiosperms from rbcL and 18S rDNA data. American
Journal of Botany 88:1499-1516.
147
Sarma, Y. S. R. K., and M. Khan. 1964. Chromosome number in some Indian species of
Nitella. Chromosoma 15:246-247.
Sasaki, M. 1961. Cytological studies in the Charophyta, with special reference to
synchronous mitosis in antheridial filaments. St. Paul's Rev. Sci. Nat. Sci. 8-9:1-
45.
Sawa, T. 1965. Cytotaxonomy of the Characeae: Karyotype analysis of Nitella opaca and
Nitella flexilis. American Journal of Botany 52:962-970.
Sawa, T., and P. W. Frame. 1974. Comparative anatomy of the Charophyta: I. Oogonia
and oospores of Tolypella with special reference to the sterile oogonial cell.
Bulletin of the Torrey Botanical Club 101:136-144.
Schopf, J. W. 1968. Microflora of Bitter Springs Formation, late Precambrian, Central
Australia. Journal of Paleontology 42:651-688.
Schopf, J. W., and J. M. Blacic. 1971. New microorganisms from the Bitter Springs
Formation (late Precambrian) of the north-central Amadeus Basin, Australia.
Journal of Paleontology 1971.
Schwarz, A.-M., M. de Winton, and I. Hawes. 2002. Species-specific depth zonation in
New Zealand charophytes as a function of light availability. Aquatic Botany
72:209-217.
Sen Gupta, S. 1988. Upper Gondwana stratigraphy and Palaeobotany of Rajmahal Hills,
Bihar (India). Palaeontologia Indica Geological Survey India 68:1-182.
Sluiman, H. J. 1985. A cladistic evaluation of the lower and higher green plants
(Viridiplantae). Pl. Syst. Evol. 149:217-232.
Sluiman, H. J., and C. Guihal. 1999. Phylogenetic position of Chaetosphaeridium
148
(Chlorophyta), a basal lineage in the Charophyceae, inferred from 18S rDNA
sequences. Journal of Phycology 35:395-402.
Smith, G. M. 1938. Freshwater Algae of the United States, New York.
Soltis, P. S., D. E. Soltis, and M. W. Chase. 1999. Angiosperm phylogeny inferred from
multiple genes as a tool for comparitive biology. Nature 402:402-407.
Souli?-M?rche, I. 1979. Origine et ?volution des genres actuels des Characeae. Bull.
Centre Rech, explor. prod. Elf Aquitaine 3:821-831.
Spence, D. H. N., and J. Crystal. 1970. Photosynthesis and zonation of freshwater
macrophytes. New Phytologist 69:217-227.
Starling, M. B., V. J. Chapman, and J. M. A. Brown. 1974. A contribution to the biology
of Nitella hookeri A. Br. in the Rotorua lakes, New Zealand. I. Inorganic
nutritional requirements. Hydrobiologia 45:91-113.
Steil, W. N. 1941. Antherozoids of some of the Characeae. Botanical Gazette 102:623-
628.
Stewart, K. D., and K. R. Mattox. 1975. Comparative cytology, evolution and
classification of the green algae with some consideration of the origin of other
organisms with chlorophylls a and b. Botanical Review 41:104-135.
Stewart, K. D., and K. R. Mattox. 1978. Structural evolution in the flagellated cells of
green algae and land plants. Biosystems 10:145-152.
Stewart, K. D., K. R. Mattox, and G. L. Floyd. 1973. Mitosis, cytokinesis, the distribution
of plasmodesmata, and other cytological characteristics in the Ulotrichales,
Ulvales, and Chaetophorales: Phylogenetic and taxonomic considerations. Journal
of Phycology 9:128-141.
149
Swofford, D. L. 1998. PAUP*-Phylogenetic Analysis Using Parsimony (*and other
methods), version 4.0b8. Sinauer Associates.
Swofford, D. L. 2002. PAUP*-Phylogenetic Analysis Using Parsimony (*and other
methods), version 4.0b10. Sinauer Associates.
Swofford, D. L., G. J. Olsen, P. J. Waddell, and D. M. Hillis. 1996. Phylogeny
reconstruction. Pages 407-514 in Molecular Systematics (D. M. Hillis, C. Moritz,
and B. K. Mable, eds.). Sinauer, Sunderland.
Syrett, P. J., and F. A. A. Al-Houty. 1984. The phylogenetic significance of the
occurrence of urease/urea amidolyase and glycollate oxidase/glycollate
dehydrogenase in green algae. British Phycological Journal 19:11-21.
Takezaki, N., A. Rzhetsky, and M. Nei. 1995. Phylogenetic test of the molecular clock
and linearized trees. Molecular Biology and Evolution 12:823-33.
Tappan, N. H. 1980. The Paleobiology of Plant Protists. W. H. Freeman, San Francisco.
Taylor, T. N., H. Hass, and W. Remy. 1992. Devonian fungi: Interactions with the green
alga Paleonitella. Mycologia 84:901-910.
Taylor, T. N., and E. L. Taylor. 1993. The Biology and Evolution of Fossil Plants.
Prentice Hall, New Jersey.
Thompson, R. H. 1969. Sexual reproduction in Chaetosphaeridium globosum (Nordst.)
Klebahn (Chlorophyceae) and description of a species new to science. Journal of
Phycology 5:285-292.
Thorne, J. L., and H. Kishino. 2002. Divergence time and evolutionary rate estimation
with multilocus data. Systematic Biology 51:689-702.
Thorne, J. L., H. Kishino, and I. S. Painter. 1998. Estimating the rate of evolution of the
150
rate of molecular evolution. Molecular Biology and Evolution 15:1647-1657.
Tindall, D. R. 1967. A new species of Nitella (Characeae) belonging to the Nitella flexilis
species group in North America. Journal of Phycology 3:229-232.
Tindall, D. R. 1970. Observations on Nitella acuminata from southwestern United States
and northern Mexico. Journal of Phycology 6:86-94.
Tindall, D. R., and T. Sawa. 1964. Chromosomes of the Characeae of the Woods Hole
(Massachusetts) region. American Journal of Botany 51:943-949.
Tiwari, R. S., and A. Tripathi. 1993. Palynological assemblages and absolute age
relationship of intertrappean beds in the Rajmahal Basin, India. Cretaceous
Research 19:53-72.
Turmel, M., C. Otis, and C. Lemieux. 2002a. The chloroplast and mitochondrial genome
sequences of the charophyte Chaetosphaeridium globosum: Insights into the
timing of the events that restructured organelle DNAs within the green algal
lineage that led to land plants. Proceedings of the National Acadamy of Sciences
of the Unites States of America 99:11275?11280.
Turmel, M., C. Otis, and C. Lemieux. 2002b. The complete mitochondrial DNA sequence
of Mesostigma viride identifies this green alga as the earliest green plant
divergence and predicts a highly compact mitochondrial genome in the ancestor
of all green plants. Molecular Biology and Evolution 19:24?38.
Uliana, M. A., and E. A. Musacchio. 1978. Microf?siles calc?reos no-marinos del
Cret?cico superior en Zampal, provincia de Mendoza, Argentina. Ameghiniana
15:111.
Vaillant, S. 1721. Characteres de quatorze genres de plantes. Mem. Acad. Roy. Sci. Paris
151
1749:17-20.
van Nes, E. H., M. Scheffer, M. S. van den Berg, and H. Coops. 2002. Dominance of
charophytes in eutrophic shallow lakes--when should we expect it to be an
alternative stable state? Aquatic Botany 72:275-296.
Vant, W. N., R. J. Davies-Colley, J. S. Clayton, and B. T. Coffey. 1986. Macrophyte
depth limits in North Island (New Zealand) lakes and differing clarity.
Hydrobiologia 137:55-60.
Vishnu-Mittre. 1952. Charophyte remains from the Jurassic of Rajmahal Hills, Behar.
Current Science 21:41-42.
Wade, P. M. 1990. The colonisation of disturbed freshwater habitats by Characeae. Folia
Geobotanica & Phytotaxonomica 25:275-278.
Wang, D. Y., S. Kumar, and S. B. Hedges. 1999. Divergence time estimates for the early
history of animal phyla and the origin of plants, animals and fungi. Proc. R. Soc.
Lond. B. Biol. Sci. 266:163-71.
Wang, S. 1965. Mesozoic and Tertiary Charophyta from Sinquan Basin of Kansu
Province. Acta Palaeontologica Sinica 13:463-499.
Wood, R. D. 1950a. Braun's "Fragmente" and the nomenclature of the Characeae-II.
Nitella mucronata. Bulletin of the Torrey Botanical Club 77:181-186.
Wood, R. D. 1950b. Stability and zonation in Characeae. Ecology 31:642-647.
Wood, R. D. 1951. The Characeae. Botanical Review 18:317-353.
Wood, R. D. 1952. An analysis of ecological factors in the occurrence of Characeae of
the Woods Hole region, Massachusetts. Ecology 33:104-109.
Wood, R. D. 1954. The Characeae of Lake Mattamuskeet, North Carolina. Journal of the
152
Elisha Mitchell Science Society 70:60-74.
Wood, R. D. 1962. New combinations and taxa in the revision of the Characeae. Taxon
11:7-25.
Wood, R. D. 1965. A Revision of the Characeae. Cramer, Weinheim.
Wood, R. D. 1972. Characeae of Australia. Nova Hedwigia 22:1-120.
Wood, R. D., and K. Imahori. 1964. A Revision of the Characeae. Cramer, Weinheim.
Wood, R. D., and R. Mason. 1977. Characeae of New Zealand. New Zealand Journal of
Botany 15.
Wray, G. A., J. S. Levinton, and L. H. Shapiro. 1996. Molecular evidence for deep
Precambrian divergences among metazoan phyla. Science 274:568-573.
Yang, Z. 1994a. Estimating the pattern of nucleotide substitution. Journal of Molecular
Evolution 39:105-111.
Yang, Z. 1994b. Maximum likelihood phylogenetic estimation from DNA sequences
with variable rates over sites: approximate methods. Journal of Molecular
Evolution 42:294-307.
Zaneveld, J. S. 1940. The Charophyta of Malaysia and adjacent countries. Blumea 4:1-
224.
Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution and genic
heterogeneity. Pages 189-225 in Horizons in Biochemistry (M. Kasha, and B.
Pullman, eds.). Academic Press, New York.
Zuckerkandl, E., and L. Pauling. 1965. Molecules as documents of evolutionary history.
Journal of Theoretical Biology 8:357-366.
Zurawski, G., and M. T. Clegg. 1987. Evolution of higher-plant chloroplast DNA-
153
encoded genes: implications for structure-function and phylogenetic studies.
Annual Review of Plant Physiology.