Plant Methods BioMed Central
ssMethodology Open Acce
Simple allele-discriminating PCR for cost-effective and rapid 
genotyping and mapping
Minh Bui1,2 and Zhongchi Liu*1
Address: 1Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, Maryland 20742, USA and 2Department of 
Biology Graduate Program, University of Maryland, College Park, Maryland 20742, USA
Email: Minh Bui - minhbui82@hotmail.com; Zhongchi Liu* - zliu@umd.edu
* Corresponding author    
Published: 8 January 2009 Received: 28 October 2008
Accepted: 8 January 2009
Plant Methods 2009, 5:1 doi:10.1186/1746-4811-5-1
This article is available from: http://www.plantmethods.com/content/5/1/1
? 2009 Bui and Liu; licensee BioMed Central Ltd. 
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), 
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background: Single nucleotide polymorphisms (SNPs) are widely observed between individuals,
ecotypes, and species, serving as an invaluable molecular marker for genetic, genomic, ecological
and evolutionary studies. Although, a large number of SNP-discriminating methods are currently
available, few are suited for low-throughput and low-cost applications. Here, we describe a
genotyping method named Simple Allele-discriminating PCR (SAP), which is ideally suited for the
small-scale genotyping and gene mapping routinely performed in small to medium research or
teaching laboratories.
Results: We demonstrate the feasibility and application of SAP to discriminate wild type alleles
from their respective mutant alleles in Arabidopsis thaliana. Although the design principle was
previously described, it is unclear if the method is technically robust, reliable, and applicable. Three
primers were designed for each individual SNP or allele with two allele-discriminating forward
primers (one for wild type and one for the mutant allele) and a common reverse primer. The two
allele-discriminating forward primers are designed so that each incorporates one additional
mismatch at the adjacent (penultimate) site from the SNP, resulting in two mismatches between
the primer and its non-target template and one mismatch between the primer and its target
template. The presence or absence of the wild type or the mutant allele correlates with the
presence or absence of respective PCR product. The presence of both wild type-specific and
mutant-specific PCR products would indicate heterozygosity. SAP is shown here to discriminate
three mutant alleles (lug-3, lug-16, and luh-1) from their respective wild type alleles. In addition, the
SAP principle is shown to work in conjunction with fluorophore-labeled primers, demonstrating
the feasibility of applying SAP to high throughput SNP analyses.
Conclusion: SAP offers an excellent alternative to existing SNP-discrimination methods such as
Cleaved Amplified Polymorphic Sequence (CAPS) or derived CAPS (dCAPS). It can also be adapted
for high throughput SNP analyses by incorporating fluorophore-labeled primers. SAP is reliable,
cost-effective, fast, and simple, and can be applied to all organisms not limited to Arabidopsis thaliana.Page 1 of 8
(page number not for citation purposes)
Plant Methods 2009, 5:1 http://www.plantmethods.com/content/5/1/1Background typing, both methods require enzymatic digestion,
Genetic and genomic research has entered a new era with increasing the cost as well as experimental time. One seri-
the ever-improving and novel sequencing technologies ous limitation of CAPS and dCAPS is that the restriction
[1]. Researchers, now more than ever, are taking advan- enzyme required could be inefficient and costly and that
tage of the available genomic information for research, incomplete enzyme digestion hinders one's ability to dis-
teaching, and applications. Single Nucleotide Polymor- tinguish heterozygocity from homozygocity of the tested
phism (SNP), the most abundant form of DNA polymor- SNP.
phisms, serves as the most valuable molecular marker for
research and application, including the detection of risk During the course of genetic research in construction of
associated alleles linked to human diseases [2], the study double mutants between leunig (lug) and leunig-homolog
of evolutionary conservations between different species (luh) [15], we encountered situations in which the dCAPS
[3], gene mapping and cloning [4], and crop breeding [5]. markers for lug and luh mutations yielded ambiguous
In many small to medium size academic laboratories as results. We first turned to direct sequencing and subse-
well as teaching laboratories around the world that utilize quently to the Amplifluor SNP HT genotyping System
Arabidopsis thaliana or other genetic model systems, SNPs [10]. These methods, while reliable, tend to have a high
have become indispensable for genotyping progeny of cost when the number of mutants requiring genotyping
genetic crosses, discriminating between mutant alleles increases. In addition, Amplifluor SNP HT requires the
from wild type alleles or isolating genes using the map- access to a real time PCR machine not readily available to
based approach. Efficient and robust genotyping assays us. We searched for alternative genotyping methods and
are also essential for the identification of individuals car- came across with the "amplification refractory mutation
rying suppressor or enhancer mutations that manifest no system (ARMS)" [16] developed more than 10 years ago
visible phenotypes of their own [6]. Therefore, robust, in mammalian systems.
reliable, inexpensive, and fast SNP-discriminating meth-
ods are needed. The ARMS technique is based on the extension of primer
only when its 3'-end is a perfect complement to the allele
Currently, a large variety of techniques for high-through- present in the input sample. However, when terminal
put SNP genotyping are available [7,8]. They can be mismatching has only weak-destabilizing effect, single
grouped into four main classes: allele-specific hybridiza- mismatch at the terminal base may not discriminate
tion, allele-specific nucleotide incorporation, allele-spe- between wild type and mutant templates. Therefore, an
cific oligonuleotide ligation, and allele-specific invasive additional deliberate mismatch is introduced at the
cleavage. For example, the TaqMan genotyping method penultimate (second to the terminal) base of the primer
[9] and the Amplifluor SNP HT genotyping System [10] to increase the specificity of the PCR reaction. As different
are PCR-based, suitable for large scale high-throughput mismatches have different destabilizing effects [16], both
applications. Both methods, however, require expensive the terminal and the penultimate mismatches are consid-
instrumentation and reagents such as synthetic oligonu- ered together. If the terminal and natural mismatch is
cleotides labeled with different fluorescent dyes. Various highly unstable, a weak additional mismatch will be
genome re-sequencing methods are also extremely power- introduced at the penultimate site, and vice versa. This
ful for large scale SNP-discrimination [11,12], yet are principle is further elaborated recently in a graphic dial
impractical for assaying a selected set of SNPs in specific [17] and can now be designed through a website http://
genomic regions, and are usually beyond the reach of bioinfo.biotec.or.th/WASP.
small to medium sized laboratories with limited
resources. Based on the principle of ARMS, we designed allele-spe-
cific primers by introducing an additional mismatch at
To date, a widely utilized SNP detection method for low- the penultimate site aimed at destabilizing base pairing
throughput applications in plant research is the Cleaved between the primers and corresponding non-target tem-
Amplified Polymorphic Sequence (CAPS), which requires plates. We demonstrate that this method offers an excel-
locus-or gene-specific primers to amplify the region of lent alternative to CAPS or dCAPS because of its
interest, followed by restriction enzyme digestion, and simplicity, low cost, robustness, speed, and reliability. We
electrophoresis [13]. In a modified CAPS method called named this method SAP (Simple Allele-discriminating
"derived CAPS" (dCAPS) [14], an engineered primer cre- PCR) instead of ARMS (amplified refractory mutation sys-
ates a restriction enzyme recognition site that can be used tem) as SAP more readily explains its application and thus
to distinguish the targeted SNP. dCAPS is more widely may help popularize its utility. We describe primer design
applicable than CAPS because it does not require the SNP rules and show the successful application of the SAP prin-
to create or destroy a restriction enzyme site. While CAPS ciple to fluorescent-labeled universal primers in allele-dis-
and dCAPS are suitable for small to medium scale geno- crimination PCR, allowing high throughput applications.Page 2 of 8
(page number not for citation purposes)
Plant Methods 2009, 5:1 http://www.plantmethods.com/content/5/1/1The SAP method provides a practical and useful alterna- A second example (Fig. 1B) shows a C (WT) to A (MT)
tive to existing genotyping methods and will greatly facil- mutation, which resulted in strong destabilizing mis-
itate plant research and teaching. matches at the terminal site between the WT and MT
primers and their corresponding non-target templates,
Results respectively. As a result, a weak destabilizing mismatch is
SAP primer design for genotyping three mutant alleles in introduced at the penultimate site. A web-based computa-
Arabidopsis thaliana tional design tool using this principle can be found at
To discriminate single base changes between wild type http://bioinfo.biotec.or.th/WASP[17].
and the mutant allele, a forward primer that exclusively
anneals to WT and another forward primer that exclu- The initial application of the SAP assay to genotyping
sively anneals to the mutant allele are designed. These two three mutant alleles, lug-16, luh-1 and lug-3, is shown (Fig.
allele-specific (AS) primers are paired with a common 2A, B; Table 2). Subsequently, several other mutations
reverse primer for standard PCR reactions. The AS primers were genotyped by the SAP (data not shown). In all cases,
are designed based on the principle that if the existing the SAP assay was successful. For example, Fig. 2A shows
SNP mismatch results in a weak destabilization between the PCR amplification of WT template with the WT (LUG)
the AS primer and its non-template target, a strong desta- primer and the amplification of lug-16 MT template by the
bilizing mismatch will be introduced at the penultimate lug-16 MT primer. It also shows the failure of PCR ampli-
site. Conversely, if the SNP mismatch already has a strong fication of WT template by the lug-16 MT primer, and fail-
destabilizing effect, a weak destabilizing mismatch should ure of PCR amplification of lug-16 MT template by the WT
be introduced at the penultimate site. If a medium desta- (LUG) primer, suggesting that the WT (LUG) and MT (lug-
bilizing effect exists at the SNP mismatch, a weak or 16) primers are highly specific to their target templates.
medium mismatch will be created at the penultimate site. Similar genotyping result was obtained for luh-1 (Fig. 2A).
In addition, Fig. 2B illustrates the utility of SAP in identi-
Table 1 indicates the weak, medium, strong, or maximum fying an F1 progeny (heterozygote) of a genetic cross
destabilization effect of each mismatched pair, based on between wild type and lug-3 mutants.
Little (1995) [16]. In general, the purine-pyrimidine mis-
pairing (G-T and A-C) are more stable and exhibit a The SAP assay is normally set up in two parallel PCR reac-
weaker destabilization effect than the purine-purine or tions. One set of PCR reaction combines the WT-specific
pyrimidine-pyrimidine mismatches as purine-pyrimidine primer with the common reverse primer. The second set
mismatches still form two hydrogen bonds in a geometry of PCR reaction combines the MT-specific primer with the
similar to G-C and A-T, and they do not require contract- same common reverse primer. When the SAP assay is first
ing or expanding the double helix. Pyrimidine-pyrimidine developed for a specific SNP, different annealing temper-
or purine-purine mispairings, in contrast, are more unsta- atures should be tested using WT and MT DNA templates
ble because of the altered geometry in the double helix as to identify the optimal annealing temperature that allows
well as reduced hydrogen bonding. For more detailed positive amplification of AS primers with respective target
analyses of thermodynamics of mismatches, one can con- templates and negative amplification with non-target
sult Peyret et al. (1999) [18]. templates. Ideally, the optimal anneal temperature for the
WT-specific amplification is the same as that of the MT-
When designing the AS primers, the specific type of nucle- specific amplification, allowing for single PCR runs. How-
otide introduced at the penultimate site should be deter- ever, this is sometimes difficult to achieve, and separate
mined by consulting Table 1. A step-by-step illustration of PCR runs using different annealing temperatures for WT
AS primer design for the seuss (seu)-1 mutant [19] is and MT-specific PCR reactions are necessary.
shown in Fig. 1A. The terminal mismatches (GT, AC) in
this case are weak destabilizing, thus a strong destabiliz- Feasibility in high-throughput applications
ing mismatch (GA) is introduced at the penultimate site. In certain instances, when large-scale analyses are
required or when there is a small amount of genetic mate-
Table 1: The strength of destabilization for all combinations of 
nucleotide pairing rial, SAP can be applied in a high-throughput and highly
sensitive manner. To demonstrate such an application,
Base Pairing Destabilization Strength the AS primer design principle was utilized and adapted to
the Amplifluor SNPs Genotyping System (Chemicon)
GA, CT, TT Maximum [10]. This technology uses energy transfer (ET) universal
CC Strong primers that generate fluorescent PCR products (Fig. 3A).
AA, GG Medium While the allele-discriminating principle is the same as
CA, GT Weak
AT, GC None SAP, the detection of the PCR products requires a machinePage 3 of 8
(page number not for citation purposes)
Plant Methods 2009, 5:1 http://www.plantmethods.com/content/5/1/1
A
WT Template 3? TCT GCT CTT CCG GAG CTA CAA 5?
seu-1 Template 3? TCT GCT CTT CCG GAG CTA TAA 5?
(1) WT Primer  5? AGA CGA GAA GGC CTC GA [] G 3?
WT Template    3? TCT GCT CTT CCG GAG CT A  C 5?
(2) MT Primer      5? AGA CGA GAA GGC CTC GA [] A 3?
MT Template    3' TCT GCT CTT CCG GAG CT A  T 5?
(3) WT Primer      5? AGA CGA GAA GGC CTC GA [] G 3?
MT Template    3' TCT GCT CTT CCG GAG CT A  T 5?
(4) MT Primer  5? AGA CGA GAA GGC CTC GA [] A 3?
WT Template    3? TCT GCT CTT CCG GAG CT A  C 5?
[]: the penultimate site is determined to be G
B
WT Template 3' ??TCAATAGC 5'
MT Template 3' ??TCAATAGA 5'
(1) penultimate (3) penultimate
WT Primer WT Primer
5? 5? G
?A   G   T   T   A   T   T   G T?A   G   T   T   A   T
?T    C   A   A  T   A   G   C ?T    C   A   A  T   A   G   A
3? 3?
WT Template MT Template
SNP SNP
(2) (4)
 MT Primer   MT Primer
5? 5? T
?A   G   T   T   A   T    T   T ?A   G   T   T   A   T T
?T   C   A   A   T   A   G   A ?T    C   A   A  T   A   G   C
3? 3?
MT Template WT Template
SNP SNP
FIlliugsutraet i1on of the SAP principle
Illustration of the SAP principle. (A) A step-by-step illustration of the AS primer design for the Arabidopsis seu-1 mutant. 
The WT (SEU) sequence and the seu-1 mutant sequence are shown on top. The mutated base is underlined. The WT (SEU)-
specific primer is first designed based on its complementarity to WT template sequence shown in (1); the MT (seu-1)-specific 
primer sequence is designed based on its complementarity to the MT template sequence shown in (2). The primer sequence is 
always from 5' (left) to 3' (right). The penultimate base in the AS primers is indicated by a bracket. Subsequently, the WT 
primer is paired against the MT template (3) to determine the terminal mismatch (GT). Similarly, MT primer sequence is paired 
against WT template sequence (4) to determine the terminal mismatch (AC). By referring to Table 1, the GT and AC terminal 
mismatches identified above both exhibit weak destabilization effect. Thus, the penultimate mismatch should exhibit a strong 
destabilization. By referring to Table 1, the strongest destabilization mismatch that involves "A" is "GA". Therefore, G is chosen 
at the penultimate site of both WT and MT AS primers. (B) Four possible annealing scenarios for a hypothetical C to A muta-
tion, which is underlined. Because the terminal mismatches (GA and TC) are strong destabilizing, the penultimate site thus 
selects a weak destabilizing mismatch (TG), which is indicated within the green rectangle. (1) Proper annealing of a WT primer 
to the WT template, which will lead to successful PCR amplification. (2) Stable annealing of the MT primer to the MT template, 
leading to successful PCR amplification. (3) Unstable pairing of the WT primer to the MT template due to two consecutive mis-
matches. No PCR product is expected. (4) Unstable pairing of the MT primer to the WT template. No PCR amplification is 
expected.
Page 4 of 8
(page number not for citation purposes)
Plant Methods 2009, 5:1 http://www.plantmethods.com/content/5/1/1capable of reading fluorescence such as a fluorescenct rescent signal (such as FAM shown in Fig. 3B) could be
plate reader or a qRT-PCR machine. significantly higher than that of the other fluorescent sig-
nal (such as JOE in Fig. 3B). Therefore, it is important to
In our experiment, the WT primer is annealed to the always include wild type and mutant control templates in
Amplifluor SNPs Genotyping primer FAM, while the MT the same experiment.
lug-16 primer is annealed to the Amplifluor SNPs Geno-
typing primer JOE. After PCR, the data was transferred to Methods
Microsoft Excel, and scatter plots were generated (Fig. 3B). Plant growth and DNA extraction
Homozygous wild type (+/+) showed a high FAM signal Arabidopsis thaliana wild type and mutant plants were
and some background JOE signal. In contrast, grown under 16-hour long day conditions at 20?C and
homozygous mutant (lug-16/lug-16) showed a high level 65% humidity for 4 weeks. One to two leaves were col-
of JOE signal and some background FAM signal. Hetero- lected from individual Arabidopsis plants, and DNA was
zygote (lug-16/+) showed significant signal from both JOE extracted using Edwards buffer (200 mM Tris, pH: 7.5;
and FAM. The successful discrimination between lug-16/ 250 mM NaCl; 25 mM EDTA, pH: 8.0; 0.5% SDS), precip-
lug-16 homozygotes, wild type (+/+), and lug-16/+ hetero- itated with isopropanol, washed with 70% ethanol, and
zygotes indicates that the SAP-based principle can be resuspended in 50 to 100 ?L distilled water, 2 ?L of which
applied to high-throughput and highly sensitive applica- (roughly about 10 ng genomic DNA) was used in 20 ?L
tions. In addition, this method is highly sensitive, requir- PCR reactions.
ing only 0.4 ng template DNA in 10 microliter PCR
reactions. DNA template was sometimes obtained through the FTA
card (Whatman) following manufacturer's instructions.
Unlike the low throughput examples discussed earlier, One single leaf was pressed onto the FTA card and allowed
both the WT and the MT AS primers are added into the to dry. 1.2 mm diameter discs were punched out of the
same PCR mix and used to amplify their target templates DNA-containing FTA cards using the 1.2 mm micro
using the same PCR program. If the two AS primers do not punch. The discs were first washed with 20 ?L FTA Purifi-
amplify their target DNA with equal efficiency, one fluo- cation Reagent (Whatman) and washed again with 20 ?L
Table 2: Primer sequences for three different alleles
SNP Primer Direction Sequence (5'-3')
lug-16 WT-Specific Reverse CCACCAGGTGCGTCAATATC
Mutant-Specific Reverse CCACCAGGTGCGTCAATATT
Common Forward TTGTATGCAAGTATGTGACTTTA
lug-16* (Amplifluor) WT-FAM Reverse GAAGGTGACCAAGTTCATGCTTCCACCAGGTGCGTCAATATC
Mutant-JOE Reverse GAAGGTCGGAGTCAACGGATTTCCACCAGGTGCGTCAATATT
Common HT Forward CTGCAGTTGCTCTGTTTCCTAA
luh-1 WT-Specific Forward GGAGGGTTTCTTTTTGAGTTG
Mutant-Specific Forward TGGAGGGTTTCTTTTTGAGTTA
Common Reverse CCATGATGGTTTGTTGCTGAT
lug-3 WT-Specific Reverse TTGATGTTGTTGTTGCTGCGG
Mutant-Specific Reverse TTGATGTTGTTGTTGCTGCCA
Common Forward ACTAAGCTGGAGTATTTCTATTT
*: The underlined sequences are 5' extended primer sequences that specifically pair with the 3' region of the FAM or JOE universal fluorescent 
primers, respectively of the Amplifluor SNPs Genotyping System.Page 5 of 8
(page number not for citation purposes)
Plant Methods 2009, 5:1 http://www.plantmethods.com/content/5/1/1FSAigPu-breas e2d genotyping of three different mutant alleles
SAP-based genotyping of three different mutant alleles. (A) WT LUG and MT lug-16 genotypes were identified by the 
positive amplification of a 401 bp band when the WT (LUG) primer and the lug-16 MT primer amplify their WT and MT target 
template DNA, respectively. Similarly, WT (LUH) and MT luh-1 genotypes were identified when a 456 bp PCR fragment was 
amplified with respective primers. (B) Presence of WT (LUG) and MT lug-3 template DNA correlates with the amplification of 
a 301 bp PCR band using respective WT (LUG) and MT lug-3 primers. A heterozygote (F1 progeny of a cross between wild 
type and lug-3) correlates with the positive PCR amplifications with both WT (LUG) or MT lug-3 primers.
1? TE buffer. Each DNA disc was used directly in individ- BioRad's iQ5 Multicolor Real-Time PCR Detection System
ual PCR reactions. and software.
Primers and PCR Discussion
Primers were designed as described in the Result section. We describe a simple SNP-discriminating method and
PCR program for all alleles described here was the same, demonstrate its utility for plant research. Although the
beginning with 94?C for 3 minutes, followed by 35 cycles design principle was previously described [16,17], it is
of 94?C for 20 seconds, 55?57?C for 20 seconds, and unclear if it has been successfully utilized in any organ-
72?C for 40 seconds, and ended by 72?C for 3 minutes. isms, nor is it known if the method is technically robust,
WT and MT primer pairs were designed to have similar reliable, and applicable.
annealing temperatures to allow simultaneous PCR.
Primer sequences are provided in Table 2. Standard PCR Several important lessons were learned in the course of
reaction was used with the final primer concentration at developing the SAP assay. First, a primer that is too stable
0.5 ?M and the final dNTP concentration at 0.2 ?M in a 20 will not distinguish between the target and the non-target
?L PCR reaction. Taq DNA Polymerase was purchased templates. In contrast, an unstable primer will not effec-
from GeneScript Corporation (Cat# E00007). 1% agarose tively amplify its target template. To weaken undesirable
gels were made with Invitrogen's UltraPure Agarose. 5 ?L stability between the primer and its non-template target,
PCR reaction was loaded in each lane of the 1% agarose either the primer length is reduced, or the PCR annealing
gel. temperature is increased. The general rule of thumb is to
maintain primer G/C contents at 36% to 66%, primer
High-throughput application length between 18 and 22 bases, the amplicon size
The Amplifluor SNPs Genotyping System for Assay Devel- around 200?600 bases, and the annealing temperature
opment kit was purchased from Chemicon International between 55?C to 60?C. WT and MT allele-specific primers
(Millipore Cat# S7907). AS primers for WT LUG and MT are best kept at similar length to allow for same PCR con-
lug-16 were designed with a 5' tail sequence identical to ditions. When the last nucleotide at the 3' end of the AS-
the 3' region of the FAM or JOE universal primers, respec- primer is a G or C, there is often an increased likelihood
tively (Table 2). PCR reaction mixture and PCR program of a faint, non-specific background PCR band. Accord-
were set up following the manufacturer's instruction and ingly, an increase in annealing temperature or a shorten-
using the Platinum Taq DNA Polymerase (Invitrogen). ing of primer length may be necessary. Finally, PCR
End-point fluorescence detection was carried out using conditions have to be first optimized using the wild typePage 6 of 8
(page number not for citation purposes)
Plant Methods 2009, 5:1 http://www.plantmethods.com/content/5/1/1
FAidgauprtaet i3on of SAP for high throughput applications
Adaptation of SAP for high throughput applications. (A) Diagram illustrating the Amplifluor SNP genotyping assay sys-
tem. The allele-specific primer each has a unique 5' tail sequence that is identical to the 3' region of one of the Amplifluor SNP 
Universal Primers (FAM or JOE indicated by green and red arrows respectively). When combined with the common reverse 
primer, PCR amplification results in the synthesis of the tail sequence complement (thin red line). The Amplifluor? SNPs Uni-
versal Primer then anneals specifically to the tail of reverse complement and is elongated by Taq Polymerase. Subsequent PCR 
cycles unfold the hairpin structure (indicated by filled circle) of the Amplifluor? SNPs Universal Primers, which results in fluo-
rescent signals. (B) A scatter plot showing results of a SAP-based Amplifluor SNP assay. X-axis represents the FAM signal 
measuring the amplification of WT LUG (+), and the Y-axis indicates the JOE signal that measures lug-16-specific PCR amplifi-
cation. Two types of controls were used. First, the manufacturer's template controls (GG, GT, TT) utilize FAM/JOE SNP prim-
ers and the control templates (GG, TT, and GT), both of which are provided by the manufacturer's kit. Second, the non-target 
control (NTC) uses water instead of DNA template. Results of three experimental samples (lug-16/lug-16, lug-16/+, and +/+) 
are shown. DNA template was from known genotype. The experiment has been performed twice with similar results. The 
result from one such an experiment is shown.
Page 7 of 8
(page number not for citation purposes)
Plant Methods 2009, 5:1 http://www.plantmethods.com/content/5/1/1and mutant DNA template controls. PCR optimizing runs 11. Huang J, Wei W, Zhang J, Liu G, Bignell GR, et al.: Whole genome
on a temperature gradient are highly recommended when DNA copy number changes identified by high density oligo-nucleotide arrays.  Hum Genomics 2004, 1:287-299.
one develops the SAP assay. It is also possible to further 12. Shapero MH, Zhang J, Loraine A, Liu W, Di X, et al.: MARA: a novel
optimize the assay by adjusting appropriate primer and approach for highly multiplexed locus-specific SNP genotyp-
ing using high-density DNA oligonucleotide arrays.  Nucleic
dNTP concentrations. Acids Res 2004, 32:e181.
13. Konieczny A, Ausubel FM: A procedure for mapping Arabidop-
Conclusion sis mutations using co-dominant ecotype-specific PCR-basedmarkers.  Plant J 1993, 4:403-410.
The aforementioned SAP method described is a cost-effec- 14. Neff MM, Turk E, Kalishman M: Web-based primer design for
tive, time-efficient, robust and reliable method for the single nucleotide polymorphism analysis.  Trends Genet 2002,
identification and discrimination of different alleles. SAP 18:613-615.15. Sitaraman J, Bui M, Liu Z: LEUNIG_HOMOLOG and LEUNIG
offers several advantages over existing CAPS and dCAPS perform partially redundant functions during Arabidopsis
genotyping assays and can be adapted for high-through- embryo and floral development.  Plant Physiol 2008, 147:672-681.
16. Little S: Amplification-refractory mutation system (ARMS)
put applications. SAP may be broadly applied to a wide analysis of point mutations.  Curr Protoc Hum Genet 2001, Chap-
range of research in any organism. ter 9:Unit 9.8.
17. Wangkumhang P, Chaichoompu K, Ngamphiw C, Ruangrit U,
Chanprasert J, et al.: WASP: a Web-based Allele-Specific PCR
Abbreviations assay designing tool for detecting SNPs and mutations.  BMC
AS: Allele Specific; PCR: Polymerase Chain Reaction; SAP: Genomics 2007, 8:275.
Simple Allele-discriminating PCR; SNP: Single Nucleotide 18. Peyret N, Seneviratne PA, Allawi HT, SantaLucia J Jr: Nearest-neighbor thermodynamics and NMR of DNA sequences with
Polymorphism; WT: Wild Type; MT: Mutant; WASP: Web- internal A.A, C.C, G.G, and T.T mismatches.  Biochemistry
based Allele-Specific PCR. 1999, 38:3468-3477.
19. Franks RG, Wang C, Levin JZ, Liu Z: SEUSS, a member of a novel
family of plant regulatory proteins, represses floral home-
Competing interests otic gene expression with LEUNIG.  Development 2002,
The authors declare that they have no competing interests. 129:253-263.
Authors' contributions
MB and ZL conceived the project, designed experiments,
and prepared the manuscript. MB conducted the experi-
ments. ZL acquired funding and approved the final ver-
sion of the manuscript.
Acknowledgements
Our work is supported by the National Science Foundation Grant 
IOB0616096 to ZL.
References
1. Service RF: Gene sequencing. The race for the $1000 genome.
Science 2006, 311:1544-1546.
2. Eberle MA, Ng PC, Kuhn K, Zhou L, Peiffer DA, et al.: Power to
detect risk alleles using genome-wide tag SNP panels.  PLoS
Genet 2007, 3:1827-1837.
3. Hillier LW, Miller RD, Baird SE, Chinwalla A, Fulton LA, et al.: Com-
parison of C. elegans and C. briggsae Genome Sequences
Reveals Extensive Conservation of Chromosome Organiza-
tion and Synteny.  PLoS Biol 2007, 5:e167.
4. Wang C, Liu Z: Arabidopsis ribonucleotide reductases are crit-
ical for cell cycle progression, DNA damage repair, and plant
development.  Plant Cell 2006, 18:350-365.
5. Rafalski A: Applications of single nucleotide polymorphisms in Publish with BioMed Central   and e very 
crop genetics.  Curr Opin Plant Biol 2002, 5:94-100.
6. Resnick JS, Wen CK, Shockey JA, Chang C: REVERSION-TO- scientist can read your work free of charge
ETHYLENE SENSITIVITY1, a conserved gene that regu- "BioMed Central will be the most significant development for 
lates ethylene receptor function in Arabidopsis.  Proc Natl Acad
Sci USA 2006, 103:7917-7922. disseminating the results of biomedical research in our lifetime."
7. Kwok PY: Methods for genotyping single nucleotide polymor- Sir Paul Nurse, Cancer Research UK
phisms.  Annu Rev Genomics Hum Genet 2001, 2:235-258.
8. Gut IG: Automation in genotyping of single nucleotide poly- Your research papers will be:
morphisms.  Hum Mutat 2001, 17:475-492. available free of charge to the entire biomedical community
9. Livak KJ, Marmaro J, Todd JA: Towards fully automated genome- peer reviewed and published immediately upon acceptance
wide polymorphism screening.  Nat Genet 1995, 9:341-342.
10. Myakishev MV, Khripin Y, Hu S, Hamer DH: High-throughput SNP cited in PubMed and archived on PubMed Central 
genotyping by allele-specific PCR with universal energy- yours ? you keep the copyright
transfer-labeled primers.  Genome Res 2001, 11:163-169.
Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishing_adv.aspPage 8 of 8
(page number not for citation purposes)