ABSTRACT 
 
 
 
Title of Document: 
!"#$%$&'()*!$+,"-)(../)')0$1)"-)+2,)
-'-$&'02"-,)
  
 Michael Hoover Johannes Rhodin, Ph.D.,  2011 
  
Directed By: Profesor Jonathan David Dinman, Cel Biology 
Molecular Genetics 
 
 
Comprised of two major subunits of both rRNA and proteins, the ribosome is 
a biological nanomachine, acting as the central player in the proces of protein 
translation. Recent advances in molecular imaging have enabled the visualization of 
the disparate functional centers within the ribosome, leading to the question of how 
these critical regions coordinate their actions and communicate with each other. This 
work examines the esential ribosomal protein L11, located in the central 
protuberance of the large subunit. L11 maintains connections with the 5S rRNA, H84 
of the 25S rRNA, comes in close proximity to the T-loop of the bound peptidyl 
tRNA, and shares an intersubunit bridge with smal subunit protein S18. L11 was 
found to have a critical dynamic loop which samples the occupancy status of the P-
site pocket of the ribosome and communicates this information through H84. L11?s 
intersubunit bridge (the B1b/c bridge) mediates an intersubunit communication 
network from the decoding center to the peptidyl transferase center of the ribosome. 
L11 is also involved in proper subunit joining. Mutations in L11 were found to have 
efects on A- and P-site tRNA binding, translational fidelity, and growth and viability 
of yeast cels.  
 
 
 
 
RIBOSOMAL PROTEIN L11: A COG IN THE NANOMACHINE 
 
 
 
By 
 
 
Michael Hoover Johannes Rhodin 
 
 
 
 
 
Disertation submited to the Faculty of the Graduate School of the 
University of Maryland, College Park, in partial fulfilment 
of the requirements for the degree of 
Doctor of Philosophy 
2011 
 
 
 
 
 
 
 
 
 
Advisory Commite: 
Profesor Jonathan Dinman, Chair 
Asistant Profesor Brenda Fredericksen 
Asistant Profesor Volker Briken 
Asociate Profesor Steve Mount 
Asociate Profesor Jason Kahn, Dean?s Representative 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
? Copyright by 
Michael Hoover Johannes Rhodin 
2011 
 
 
 
 
 
 
 
 
 
 
  
 
 
 
 
 
 
ii 
 
 
Dedication 
I wish to dedicate this work to my parents for giving me the tools and the 
encouragement to reach as high as I desire, and to my wife Elyse for her love and 
support through every step of the way. 
 
 
 
 
 
 
 
 
 
iii 
 
 
Acknowledgements 
 I would like to thank my advisor Dr. Jonathan D. Dinman for his years of 
counsel and support, to my commite for their time and asistance in improving my 
research, and to every member of the Dinman Laboratory for their asistance. In 
particular, I want to extend a special thanks to Dr. Rasa Rakauskaite for her years of 
guidance and insightful discussions.  
This work was supported in part by a National Institute of Health grant to 
Dr. Jonathan D. Dinman R01 GM058859.  
 
 
iv 
Table of Contents 
!"#$%$&'()*!$+,"-)(../)')0$1)"-)+2,)-'-$&'02"-,3333333333333333333333333333333333334)
567489:4;<3333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333344!
'8=<;>?67@6A6<:B33333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333444!
+9C?6);D)0;<:6<:B3333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333334E!
+9C?6);D)+9C?6B3333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333E4!
+9C?6);D)F4@GH6B33333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333E44!
(4B:);D)'CH6E49:4;<B33333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333E44!
0I9J:6H).33333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333.)
"<:H;7G8:4;<3333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333.!
"#$%&%'()!*%+,-%)%./000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001!
"#$%&%'2!3#%.242&#&!562+6#2700000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000008!
9+(4&)(:#%40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;<!
=4#:#(:#%4000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;<!
>)%4.(:#%4000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001?!
@'#4%(A/)B:"C@!&2)2A:#%4!(4D!(A%'%D(:#%400000000000000000000000000000000000000000000000000000000000000000000000000000000001;!
E2,:#D/)!9+(4&F2+0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001G!
9+(4&)%A(:#%400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001H!
92+'#4(:#%4000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001I!
9+(4&)(:#%4()!"2A%D#4.0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000G1!
E+%.+('2D!B;!"#$%&%'()!J+('2&-#F:#4.0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000GG!
E+%.+('2D!K;!"#$%&%'()!J+('2&-#F:#4.000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000H1!
*#&24&2!(4D!C%4&24&2!LM,+2&#%400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000HN!
LA%,2!%F!O%+P0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000HQ!
0I9J:6H)K33333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333LM)
')D?6N4C?6)?;J)4<)O69B:)H4C;B;A9?)JH;:64<)(.)8;H74<9:6B)*PB4:6):!-')
C4<74<@333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333LM!
=4:+%DMA:#%400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000H8!
*(:2+#()&!(4D!*2:-%D&0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000<Q!
L:+(#4&R!,)(&'#D&R!(4D!'2D#(0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000<Q!
S2)!.+%7:-!(4D!D+M.!+2&#&:(4A2T&24&#:#6#:/!,-24%:/,2&00000000000000000000000000000000000000000000000000000000000000000<8!
9+(4&)(:#%4()!J#D2)#:/!@&(/&000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000<8!
"#$%&%'2!,+2,(+(:#%40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000N1!
@&&(/&!%F!+#$%&%'2T:"C@!#4:2+(A:#%4&0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000NH!
+"C@!L:+MA:M+()!@4()/&#&!M&#4.!LU@E>0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000NN!
S%',M:(:#%4()!(4()/&2&!(4D!+#$%&%'2!&:+MA:M+2!6#&M()#V(:#%400000000000000000000000000000000000000000000000000000N8!
"2&M):&0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000N8!
W242+(:#%4!(4D!#4#:#()!A-(+(A:2+#V(:#%4!%F!+,);$!()2)2&00000000000000000000000000000000000000000000000000000000000000000N8!
9-2!X;!EB&#:2!)%,!'M:(4:&!A%4F2+!:2',2+(:M+2B!(4D!D+M.B&,2A#F#A!.+%7:-!
,-24%:/,2&0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000Q;!
9-2!!"#$%!'M:(4:&!(F2A:!:+(4&)(:#%4()!F#D2)#:/0000000000000000000000000000000000000000000000000000000000000000000000000000000000QH!
9-2!'M:(4:!!"&$'!()2)2&!,+%'%:2!%,%&#4.!2F2A:&!%4!:"C@!$#4D#4.!:%!:-2!
+#$%&%'()!@B!(4D!EB&#:2&0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000QQ!
9-2!EB&#:2!)%,!#&!F)2Y#$)2!D2,24D#4.!%4!:-2!%AAM,(4A/!&:(:M&!%F!:-2!EB&#:20000000000000000000000000000I?!
Z#&AM&#%4000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000I<!
0I9J:6H)Q33333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333MK)
"76<:4D489:4;<);D)9)-6:>;H=);D)"<D;HA9:4;<)F?;>):IH;G@I):I6)!4C;B;A9?)
#.CR8)"<:6HBGCG<4:)#H47@633333333333333333333333333333333333333333333333333333333333333333333333333333333333MK!
 
 
v 
=4:+%DMA:#%40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000081!
*(:2+#()&!(4D!*2:-%D&00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000008<!
"2&M):&00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000008N!
W242+(:#%4!%F!!"&$!()2)2&!(4D!.242:#A!(4()/&2&0000000000000000000000000000000000000000000000000000000000000000000000000000000008N!
S-(4.2&!:%!:-2!3;$TA!$+#D.2!(FF2A:!:+(4&)(:#%4()!F#D2)#:/00000000000000000000000000000000000000000000000000000000000000;??!
3;$TA!$+#D.2!'M:(4:&!():2+!:"C@!$#4D#4.0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;?G!
"#$%&%'2!&:+MA:M+()!A%4F%+'(:#%4&!(+2!#4F)M24A2D!$/!:-2!3;$TA!$+#D.2000000000000000000000000000000;?H!
Z#&AM&#%4000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;?8!
0I9J:6H)L333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333..M)
(..)I6?JB)A6749:6)BGCG<4:)S;4<4<@)7GH4<@)H4C;B;A9?)4<4:49:4;<3333333333333333333333333333..M!
=4:+%DMA:#%400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;;8!
*(:2+#()&!(4D!*2:-%D&0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;11!
LMA+%&2!D24&#:/!.+(D#24:!F+(A:#%4(:#%40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;1G!
"2&M):&0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;1H!
W242+(:#%4!%F!!"#$!()2)2&!(4D!.242:#A!(4()/&2&00000000000000000000000000000000000000000000000000000000000000000000000000000;1H!
X;;!'M:(:#%4&!(FF2A:!:+(4&)(:#%4()!F#D2)#:/0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;18!
9-2!J8NR!@NZ!'M:(4:&!A%4F2+!&M$M4#:![%#4#4.T+#$%&%'2!$#%.242&#&!D2F2A:&00000000000000000000;G1!
3#%A-2'#A()!(4D!&:+MA:M+()!(4()/&2&000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;G<!
Z#&AM&#%4000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;G8!
0I9J:6H)T333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333.LL)
0;<8?GB4;<B)9<7)FG:GH6)54H68:4;<B3333333333333333333333333333333333333333333333333333333333333333333333333333333333.LL!
'J6<74N)'/)U69B:)%:H94<)(4B:3333333333333333333333333333333333333333333333333333333333333333333333333333333333333.TK)
'J6<74N)#/)U69B:)*?9BA47)(4B:333333333333333333333333333333333333333333333333333333333333333333333333333333333.TT)
'J6<74N)0/)$?4@;<G8?6;:476)*H4A6H)(4B:333333333333333333333333333333333333333333333333333333333333333.TV)
 
 
 
 
 
vi 
 
Table of Tables 
9@3X>!;0!=C9>"L\3\C=9!3"=ZW>!Z>LS"=E9=5CL000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000008!
9@3X>!10!5X=W5C\SX>59=Z>L!\L>Z!J5"!E"=*>"!>]9>CL=5C!=C!LU@E>!@C@X^L>L00000000000000000000000000000000000000000000000000N8!
9@3X>!G0!L\**@"^!5J!>]E>"=*>C9@X!J=CZ=CWL!J5"!9U>!<;BH@!@CZ!<HBQ@!*\9@C9L!5J!^>@L9!X;;000000000000QQ!
9@3X>!H0!"C@!3@L>!*5Z=J=S@9=5C!">L\X9=CW!J"5*!X;;!*\9@9=5CL!@C@X^_>Z!3^!LU@E>00000000000000000000000000;?8!
9@3X>!<0!^>@L9!L9"@=CL!E"5Z\S>Z0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;<1!
9@3X>!N0!EX@L*=ZL!E"5Z\S>Z00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;<<!
9@3X>!Q0!5X=W5C\SX>59=Z>L!\L>Z!=C!L=9>!Z=">S9>Z!*\9@W>C>L=L00000000000000000000000000000000000000000000000000000000000000000000000;<I!
 
 
 
vii 
 
 
Table of Figures 
J=W\">!;0!"=35L5*>!*5"EU5X5W^00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000H!
J=W\">!10!9"C@!*5"EU5X5W^000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000N!
J=W\">!G0!=C9>"L\3\C=9!3"=ZW>L!=C!1!S5CJ5"*@9=5CL000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000I!
J=W\">!H0!""C@!E"5S>L=CW!LSU>*@9=S0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;;!
J=W\">!<0!L\3\C=9!3=5W>C>L=L!LSU>*@9=S0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;H!
J=W\">!N0!"=35L5*@X!=C=9=@9=5C!LSU>*@9=S00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;I!
J=W\">!Q0!=">LB*>Z=@9>Z!=C=9=@9=5C0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001?!
J=W\">!I0!`=C>9=S!LSU>*@9=S!5J!@@B9"C@!L>X>S9=5C!@CZ!@S5**5Z@9=5C00000000000000000000000000000000000000000000000000000011!
J=W\">!80!E5L=9=5C!5J!9"C@L!=C!Z=JJ>">C9!L=9>L!5J!9U>!"=35L5*>00000000000000000000000000000000000000000000000000000000000000000000001N!
J=W\">!;?0!L9"\S9\"@X!*@E!5J!>"J;!Z5*@=CL0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000018!
J=W\">!;;0!*5X>S\X@"!*=*=S"^!3>9O>C!>"J;!@CZ!9"C@000000000000000000000000000000000000000000000000000000000000000000000000000000000000G?!
J=W\">!;10!E"5Z\S9L!@CZ!@C@95*^!5J!@!B;!E"J!L=WC@X0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000GN!
J=W\">!;G0!>]@*EX>L!5J!a="@X!*"C@!EL>\Z5`C59L00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000GQ!
J=W\">!;H0!*>SU@C=L9=S!*5Z>XL!5J!B;!E"J00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000G8!
J=W\">!;<0!W>C>!X@^5\9!@CZ!K;!E"J!L=WC@X!5J!9^$!@CZ!9^(00000000000000000000000000000000000000000000000000000000000000000000000000000000H<!
J=W\">!;N0!*\X9=EX>!L>b\>CS>!@X=WC*>C9!5J!X;;000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000<1!
J=W\">!;Q0!X5S@X=_@9=5C!5J!X;;!O=9U=C!9U>!"=35L5*>0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000<G!
J=W\">!;I0!*\X9=EX>!L>b\>CS>!@X=WC*>C9!5J!X;;!EBL=9>!X55EL00000000000000000000000000000000000000000000000000000000000000000000000000<H!
J=W\">!;80!X;;!L9"\S9\"@X!S5CL>"a@9=5C!@S"5L!LE>S=>L!O=9U!J5S\L!5C!9U>!EBL=9>!X55E000000000000000000000000<<!
J=W\">!1?0!*@E!J5"!O=XZB9^E>!X;;3!EX@L*=Z000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000<8!
J=W\">!1;0!Z\@X!X\S=J>"@L>!L^L9>*0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000N?!
J=W\">!110!L9"\S9\">!5J!E\"5*^S=C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000NH!
J=W\">!1G0!;*Q!SU>*=S@X!*5Z=J=S@9=5C!5J!"C@0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000NI!
J=W\">!1H0!EU>C59^E=S!@C@X^L>L!5J!9U>!a=@3X>!X;;!*\9@C9L000000000000000000000000000000000000000000000000000000000000000000000000000000Q1!
J=W\">!1<0!9U>!X;;3!*\9@C9L!E"5*59>!Z>J>S9L!=C!9"@CLX@9=5C@X!J=Z>X=9^0000000000000000000000000000000000000000000000000Q<!
J=W\">!1N0!9U>!X;;3!*\9@C9L!E"5*59>!5EE5L=9>!`
Z
L!J5"!9"C@!LE>S=>L00000000000000000000000000000000000000000000000000000000Q8!
J=W\">!1Q0!GBZ=*>CL=5C@X!">E">L>C9@9=5C!5J!""C@L!E"53>Z!3^!LU@E>00000000000000000000000000000000000000000000000000000000I;!
J=W\">!1I0!X;;!*\9@C9L!E"5*59>!X5S@X!@CZ!Z=L9@C9!SU@CW>L!=C!""C@!L9"\S9\">000000000000000000000000000000000000IH!
J=W\">!180!*5Z>Xc!9U>!EBL=9>!X55E!@S9L!@L!@!L>CL5"!5J!9U>!5SS\E@CS^!L9@9\L!5J!9U>!EBL=9>0000000000000000000II!
J=W\">!G?0!X5S@9=5C!5J!X;;!=C!9U>!"=35L5*>00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000008H!
J=W\">!G;0!EU>C59^E=S!@C@X^L>L!5J!9U>!a=@3X>!X;;!*\9@C9L0000000000000000000000000000000000000000000000000000000000000000000000000000008Q!
J=W\">!G10!9U>!X;;!3;3TS!3"=ZW>!*\9@C9L!@JJ>S9!9"@CLX@9=5C@X!J=Z>X=9^00000000000000000000000000000000000000000000000;?;!
J=W\">!GG0!9U>!X;;3!*\9@C9L!@J>S9!Z=L5S=@9=5C!S5CL9@C9L!J5"!9"C@L0000000000000000000000000000000000000000000000000;?H!
J=W\">!GH0!X;;!*\9@C9L!E"5*59>!X5S@X!@CZ!Z=L9@C9!SU@CW>L!=C!""C@!L9"\S9\">0!0000000000000000000000000000000;?Q!
J=W\">!G<0!X5S@9=5C!5J!@X9>">Z!""C@!3@L>L000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;?I!
J=W\">!GN0!E5L=9=5C!5J!"=35L5*@X!E"59>=C!X;?!">X@9=a>!95!C>@"3^!*5Z=J=>Z!3@L>L00000000000000000000000000000000;;1!
J=W\">!GQ0!E"5E5L>Z!dO="=CW!Z=@W"@*e!*5Z>X!5J!@X5L9>"=S!=CJ5"*@9=5C!JX5O!9U"5\WU!9U>!3;3TS!
=C9>"L\3\C=9!3"=ZW>00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;;G!
J=W\">!GI0!X;;fL!E5L=9=5C!O=9U=C!9U>!"=35L5*>0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;1;!
J=W\">!G80!*\X9=EX>!L>b\>CS>!@X=WC*>C9!5J!X;;000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;1N!
J=W\">!H?0!EU>C59^E=S!@C@X^L>L!5J!9U>!a=@3X>!X;;!*\9@C9L000000000000000000000000000000000000000000000000000000000000000000000000000;1Q!
J=W\">!H;0!X;;3!*\9@C9L!@X9>"!9"@CLX@9=5C@X!J=Z>X=9^0000000000000000000000000000000000000000000000000000000000000000000000000000000000;G;!
J=W\">!H10!E5X^L5*>!E"5J=X=CW000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;GH!
J=W\">!HG0!L\3\C=9!E"5J=X=CW000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;GH!
J=W\">!HH0!@B!@CZ!EBL=9>!9"C@!3=CZ=CW!`
Z
L000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;GN!
J=W\">!H<0!SU>*=S@X!E"59>S9=5C!@C@X^L=L!5J!@NNZ000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000;GI!
J=W\">!HN0!=C9>"@S9=5C!3>9O>C!X;;!X5E!@CZ!>BL=9>!9"C@000000000000000000000000000000000000000000000000000000000000000000000000000;<?!
 
 
 
vii 
 
 
List of Abreviations 
1M7 1-methyl-7-nitroisatoic anhydride 
aa-tRNA Aminoacyl-transfer RNA 
ASL Anticodon stem loop 
ATP Adenosine triphosphate 
CDS Coding sequence 
CMCT 1-cyclohexyl-3-(2-morpholinoethyl) carbodiimide metho-p-toluene 
CP Central protuberance 
Cryo-EM Cryogenic electron microscopy 
DC Decoding center 
DMS Dimethyl sulfate 
DMSO Dimethylsulfoxide 
dsRNA Double stranded RNA 
eEF Eukaryotic elongation factor 
eEF1A Eukaryotic elongation factor 1A 
eEF2 Eukaryotic elongation factor 2 
EF Elongation factor 
EF-G Elongation factor G 
EF-Tu Elongation factor Tu 
eIF Eukaryotic initiation factor 
eRF Eukaryotic release factor 
ES Expansion segment 
FRET F?rster resonance energy transfer 
FS Frameshifting 
GGQ Glycine-glycine-glutamine motif 
GDP Guanosine diphosphate 
GTP Guanosine triphosphate 
HIV-1 Human imunodeficiency virus type 1 
HPLC High performance liquid chromatography 
IBV Infectious bronchitis virus 
IF Initiation factor 
IRES Internal ribosome entry site 
KET Kethoxal 
LSU Large subunit 
M
7
G 7-methylguanosine 
mRNA Mesenger RNA 
NIKS Asparagine-isoleucine-lysine-serine motif 
OD Optical density (at a specific wavelength) 
ODC Ornithine decarboxylase 
ORF Open reading frame 
PABP Poly-adenosine binding protein 
PMSF Phenylmethylsulfonyl fluoride 
pol Polymerase 
 
 
ix 
poly A Poly-adenosine 
post-TC Post termination complex 
PRF Programed ribosomal frameshifting 
PTC Peptidyl transferase center 
rDNA Ribosomal DNA 
RF Release factor 
RRF Ribosome release factor 
RSV Rous sarcoma virus 
SARS Severe acute respiratory syndrome 
SHAPE Selective 2'-hydroxyl acylation analyzed by primer extension 
SRL Sarcin-ricin loop 
SSU Small subunit 
tRNA Transfer RNA 
UTR Untranslated region 
 
 
1 
Chapter 1 
Introduction 
 The conversion of information contained in nucleic acid genomes into 
functional protein products is an esential ability for al life. This proces, known as 
?translation,? is universaly performed by a complex of proteins and RNA molecules 
known as the ribosome. Along with dozens of translational factors, ribosomes decode 
the instructions contained in mesenger RNAs (mRNAs), and catalyze the formation 
of the proteins coded therein. While general principles and some specific aspects of 
the translational proces are extremely wel understood, there remain many questions, 
particularly pertaining to the molecular mechanics underlying the translational 
proces. While ribosomes are present in al living organisms, there are distinct 
diferences among ribosomes found in Bacteria, Archaea, and Eukarya. Some of 
these diferences have enabled the efective development and use of antibiotics, 
which often kil or slow the growth of bacteria by targeting critical features of the 
bacterial ribosome, while having minimal efect on eukaryotic ribosomes. Viruses 
present a diferent set of chalenges, as al viruses use their host?s ribosomes to 
translate themselves, making antibiotics inefective as a treatment method. However, 
viral genomes often coax ribosomes into employing non-canonical translational 
strategies, potentialy offering targets for future therapeutics. Obtaining a deeper 
understanding of the chemistry, structure, signaling pathways, and mechanics of the 
ribosome wil likely result in new treatments for viral and translationaly-linked 
diseases. 
 
 
 
2 
Ribosomal Morphology 
The ribosome is divided into two major complexes, designated the large (60S) 
and smal (40S) subunits. These subunits asemble to form the eukaryotic 80S 
ribosome (70S in bacteria with 50S and 30S subunits); each component is named for 
its respective sedimentation coeficient. The eukaryotic ribosome contains 4 
ribosomal RNA (rRNA) molecules: 5S, 5.8S, and 25S rRNAs in the large subunit 
(LSU), and an 18S rRNA in the smal subunit (SSU). The ribosome also contains 79 
integrated proteins, many of which are esential for succesful molecular function 
[1,2]. In addition to these rRNA molecules and embedded proteins, there are dozens 
of trans-acting factors that asist the ribosome in the construction of proteins. Each 
subunit has both overlapping and distinct roles in the translational procedure. The 
SU contains the decoding center (DC), a region responsible for decoding the mRNA 
and ensuring proper aceptance of transfer RNA (tRNA) molecules into the ribosome. 
Peptide bond formation occurs on the LSU in the peptidyl transferase center (PTC), a 
pocket consisting entirely of RNA. While the LSU contains a region of rRNA caled 
the Sarcin-Ricin loop (SRL) (located on Helix 95 of the 25S rRNA), a region which 
interacts with elongation and release factors (RFs), both the LSU and SU make 
multiple contacts with these factors [3]. Together, both subunits help stabilize and 
guide tRNA molecules through the 80S ribosome. 
Numerous cryogenic electron microscopy (cryo-EM) [1,4,5,6,7,8,9,10,11, 
12,13] and X-ray [14,15,16,17] crystalographic techniques have recently enabled the 
visualization of the ribosome at atomic level resolution and have asisted in 
elucidating the gross structural movements that occur during translation. While earlier 
 
 
3 
images depicted archaeal and bacterial species, more recent studies have focused on 
the eukaryotic ribosomes of yeast. Figure 1A depicts the yeast LSU and SU along 
with nomenclature developed to easily identify and distinguish various regions of 
each macromolecule. 
 
 
4 
 
Figure 1. Ribosome morphology. 
Cryo-EM images of S. cerevisiae yeast ribosomes, with homology construction using the thermophilic 
fungus Thermomyces lanuginosus and docked into bacterial and archaeal x-ray crystal structures [12]. 
(A) 40S viewed from intersubunit face. 18S rRNA in cyan; SU proteins in gren; h, head; bk, beak; 
nk, neck; sh, shoulder; rf, right foot; lf, left foot; pt, platform; b, body, A, P, E, for tRNAs in red, blue, 
and yellow respectively. 60S crown viewed from intersubunit face. 5.8+25S rRNA is tan, LSU proteins 
are pink, 5S rRNA is orange. SB, stalk base; CP, central protuberance; L1, L1 stalk base; SRL, Sarcin-
Ricin loop. (B) Two views of 80S, left image color scheme is same as above. Right image entire 60S is 
tan, entire 40S is cyan, folding polypeptide chain shown in red, mRNA is purple. DC, decoding center; 
PTC, peptidyl transferase center; T, transfer site; A, acomodation/amino-acyl site; P, peptidyl site; 
E, exit site. Images generated using protein database files 3JYV, 3JYX, 3JYW, and 1G1X. 
 
As tRNA molecules interact with the ribosome they transition through several 
distinct regions. These regions are labeled the T, A, P, and E sites, standing for 
Transfer, Acommodation/Amino-acyl, Peptidyl, and Exit sites respectively. These 
 
 
5 
features are depicted in Figure 1B. The T site actualy demarcates a region outside of 
the LSU 3? (relative to the mRNA) to the translating ribosome?s forward moving 
edge. This site is occupied by the amino-acylated tRNA (aa-tRNA) and elongation 
factors while the ribosome determines its suitability for acommodation. 5? of the T 
site is the A-site, where a-tRNAs that survive the screening proces bind within the 
ribosome. Once fully acommodated in the A-site, the tRNA?s 3? CCA-amino acid 
bound end is positioned in the PTC. 5? of the A-site is the P-site, where the peptidyl-
tRNA is bound with its CCA-peptidyl end also positioned in the PTC. The ribosome 
catalyzes peptidyl transfer, deacylating the P-site tRNA and moving the polypeptide 
chain onto the A-site tRNA. The ribosome then shifts the position of the tRNA 
molecules such that the A-site tRNA now occupies the P-site, and the deacylated P-
site tRNA enters the E site. tRNAs reside in the E-site for a short period of time, 
disociating from the ribosome entirely upon the acommodation of a new a-tRNA 
into the A-site. Figure 2 depicts the 3-dimensional structure of a typical tRNA 
molecule. While recent cryo-EM and X-ray crystalographic analyses have identified 
intermediate tRNA binding states within the ribosome, the T, A, P, and E sites remain 
as dominant features and useful distinctions in understanding translation. As 
translation progreses, the growing polypeptide chain exits the ribosome via the 
ribosomal polypeptide exit tunnel, a channel roughly 20? across and 100? long, 
located betwen the PTC and the solvent side of the LSU [18,19]. This tunnel is wide 
enough for the polypeptide chain to adopt an !-helix conformation. Several studies 
have shown that the environment of the exit tunnel promotes and stabilizes such !-
helix formation [20,21,22]. 
 
 
6 
 
 
Figure 2. tRNA morphology. 
Numbering refers to nucleotide sequence of tRNA molecule. One of the twenty amino acids is bound 
to the 3? CA end of the specific tRNA molecule whose anticodon coresponds to said amino acid. 
Image generated using protein database file 1G1X. 
 
 The ribosome is a dynamic molecular complex, coordinating precise yet 
variable actions both intra- and inter-molecularly. While representing an area of 
intense research, our current knowledge of how disparate functional centers 
communicate with each other is limited. With many critical functions divided 
betwen the LSU and SU, examinations of the contacts betwen the LSU and SU, 
caled the ?intersubunit bridges,? wil likely reveal communication pathways, 
alowing asignment of function to known structures. In the eukaryotic ribosome 
there exist 16-17 intersubunit bridges, depending on the orientation of the subunits 
 
 
7 
relative to each other [1,5,9]. These are depicted in Figure 3, with detailed 
descriptions provided in Table 1. The intersubunit bridges are al composed of 
rRNA:rRNA or rRNA:protein interactions except for the B1b/c bridge, which is 
composed of a protein:protein interaction. During translation, the body of the SU 
rotates by up to 6? relative to the LSU around the fulcrum of intersubunit bridge B2c 
[17], along with a 14? rotation of the SU head which bends at the neck [15]. 
Relatively large conformational adjustments are also observed in the central 
protuberance (CP) of the LSU [1]. These movements result in the structural 
rearrangements of many of the intersubunit bridges, with the most extreme at the 
periphery of the ribosome, particularly in the B1a and B1b/c bridges, both of which 
form novel connections due to intersubunit movements [1]. Understanding the 
alosteric pathways asociated with the intersubunit bridges and their structural 
rearrangements wil undoubtedly reveal mechanisms of how the LSU and SU 
communicate with each other. 
 
 
 
8 
 
Figure 3. Intersubunit bridges in 2 conformations. 
(A, B) Pre-ratchet (term described in more detail below in Chapter 1 ?Elongation? section) 40S 
(yelow) and 60S (blue) subunits and (C, D) post-ratchet state subunits. Bridges unchanged betwen 
states are shown in gren, red depicts alterations in conformation betwen states, and pink represent 
bridges unique to a given state. Bridges unique to eukaryotes are denoted by a preceding ?e,? all others 
are shared acros all eukaryotes, archaea, and bacterial species examined to date. Intersection of dashed 
lines denote pivot site during ratcheting. This figure is from [5]. 
 
 
 
9 
 
Table 1. Intersubunit bridge descriptions. 
Table is from [9]. 
 
Ribosome Biogenesis Overview 
 Most of our knowledge pertaining to eukaryotic ribosomal biogenesis is 
derived from studies in the yeast Saccharomyces cerevisiae. In yeast, ribosome 
biogenesis begins in a specialized compartment of the nucleus caled the nucleolus 
[23,24]. Nucleolar transcription of the rRNAs requires RNA polymerases I and III 
(pol I, III). Pol I transcribes a 35S precursor rRNA from which the 5.8S, 25S, and 18S 
rRNAs ultimately arise. Pol III transcribes the 5S rRNA. In the nucleus, RNA 
polymerase II (pol II) is responsible for the transcription of mRNAs for the 79 
proteins which are incorporated into the ribosome during multiple steps of the 
biogenesis program. In addition to these components, there are over 200 non-
 
 
10 
ribosomal proteins and ~70 smal nucleolar rRNAs involved in the procesing, 
asembly, and transport of the eukaryotic ribosome (reviewed in [25,26,27]). Over 
100 rRNA base modifications are made to the pre-ribosomal rRNA as wel, including 
base methylations, ribose 2?-hydroxyl methylations, and pseudouridilations [28,29]. 
Figure 4 details many of the asembly steps for rRNA preparation. 
 
 
 
11 
 
Figure 4. rRNA processing schematic. 
The genomic 9.1 kb rDNA tandem repeat is shown at top. Procesing and cleavage sites are labeled on 
the 35S pre-rRNA operon. Color coded procesing factors are listed at each step. Figure is adapted 
from [25]. 
 
 
12 
 
The ribosomal DNA (rDNA) coding for both the 35S rRNA precursor and the 
5S rRNA al exist within a 9.1 kilobase unit, which is tandemly repeated 100-200 
times. This number of rDNA copies, coupled with multiple simultaneous pol I and 
pol III transcription events, enables the rapid production of large amounts of 
ribosomes required to met the demands of rapidly growing cels. During the proces 
of pol I transcription of the 35S pre-rRNA a series of base modifications are added. A 
sequence of 5? cleavage events follows (labeled A
0
 and A
1
), converting the 35S pre-
rRNA to 33S and then 32S precursors. The next cleavage (A
2
) separates the 18S 
rRNA from the 5.8+25S rRNA, creating the 20S and 27SA
2
 pre-rRNAs respectively. 
The 20S pre-rRNA resolves into the mature 18S rRNA, while the 27SA
2
 precursor is 
procesed along one of two pathways. 85% of the time the 27SA
2
 is cleaved at site 
A3, followed by 5? to 3? digestion to the B
1S
 site. Alternatively, 15% of the time the 
27SA
2
 molecule is procesed at the B
1L
 and B
2
 sites. Both pathways lead to the same 
conclusion, with 25S rRNAs being cleaved from the 27SB
(S/L)
 rRNAs, leaving a 7S 
rRNA which is further procesed to become the mature 5.8S rRNA. Separately, the 
5S rRNA primary transcript?s 3? end is removed, yielding the final 5S rRNA. These 
steps are asisted by a large number of proteins and smal nucleolar RNAs detailed in 
[25,26]. 
Along with the multitude of factors utilized in the procesing of the rRNA, 
hundreds of asembly proteins asist with rRNA folding, subunit formation, 
intracelular transport, and the incorporation of ribosomal proteins (reviewed in 
[30,31,32]). While rRNA is transcribed in the nucleolus, ribosomal proteins are 
 
 
13 
transcribed by pol II in the nucleus, transported to the cytoplasm for procesing, and 
then transported back into the nucleus and or the nucleolus for incorporation into the 
ribosome [32]. As the 35S pre-rRNA is being procesed in the nucleolus it forms a 
large complex, caled the 90S pre-ribosome, that begins to fold and establish 
asociations with ribosomal proteins. Figure 5 depicts the proces of protein 
incorporation, factor asistance, and transportation in general terms. Cleavage of the 
18S pre-rRNA from the 5.8S+25S pre-rRNAs yields the 43S and 66S pre-smal and 
pre-large subunits respectively, each of which contain numerous ribosomal proteins 
and asembly factors. While stil in the nucleolus, the 5S rRNA, in complex with 
ribosomal proteins L5 and L11, asociates with the 66S particle. The 43S and 66S 
subunits are actively transported out of the nucleolus and into the nucleus for 
incorporation of additional ribosomal proteins and further procesing. While much of 
this proces is stil poorly understood, in yeast the exportins Crm1, Ran, and the 
protein Nmd3 are al involved in subunit transport out of the nucleolus and through 
the nucleus. The subunits are finaly transported out of the nucleus into the cytoplasm 
where final maturation takes place, yielding the 40S and 60S subunits. 
 
 
 
14 
 
Figure 5. Subunit biogenesis schematic. 
Flow chart depicting celular location and general sequence of ribosome biogenesis and ribosomal 
protein incorporation steps. Figure is from [30]. 
 
 
 
15 
Translation 
 It has been estimated that healthy yeast produce up to 2,000 ribosomes per 
minute per cel [33]. Cels devote enormous amounts of energy into the production of 
ribosomes, and their subsequent protein synthesis. In direct relation to this energy 
expenditure, ribosomes have evolved to translate mRNAs with both precision and 
speed, making approximately one mistake every 3,000 codons read, while asembling 
10-20 amino acids into a growing polypeptide chain every second [34,35]. The 
proces of translation can be divided into three stages: initiation, elongation, and 
termination. While each stage of translation is asisted by trans-acting protein factors, 
the specific types and numbers are often diferent betwen bacterial and eukaryotic 
systems. Here the focus wil be on the eukaryotic system. 
Initiation is the proces by which the ribosome asociates with the mRNA, 
identifies and positions itself at the AUG start codon. Elongation consists of the 
ribosome moving in the 5? to 3? direction along the mRNA, reading 3-nucleotide 
triplet codons per step, and incorporating appropriate amino acids into the growing 
polypeptide chain. Termination results in the release of the polypeptide chain from 
the ribosome following recognition of a termination codon in the DC, and either the 
subsequent division of the subunits and separation from the mRNA, or the recycling 
of the ribosome back onto the start of the mRNA strand.  
 
Initiation 
 Initiation is the proces by which the large and smal ribosomal subunits are 
joined on the mRNA and positioned at the AUG start codon. This is a multistep 
 
 
16 
procedure aided by a variety of trans-acting eukaryotic initiation factors (eIFs) as 
depicted in Figure 6 below. Ribosomal 40S and 60S subunits can be recruited in one 
of two ways: either from a standing population of individual subunits (de novo), or 
from an 80S post termination complex (post-TC) which must be divided into separate 
subunits and primed for a new round of translation (recycled). Much is stil unknown 
regarding exact mechanisms by which post-TCs are recycled, but recent data suggests 
that initiation factors ABCE1, eIF1, eIF1A, and eIF3 interact with the 80S molecule 
[36], causing a disociation of the subunits from the mRNA, any residual RFs, and 
any deacylated tRNA, resulting in empty 40S and 60S subunits [37]. In de novo 
initiation, eIF1, eIF1A, eIF3, and eIF5 bind to the SU, recruiting the eIF2:GTP:Met-
tRNA
Met
i
 ternary complex to bind to the SU, resulting in the 43S pre-initiation 
complex. eIF1A binds to the A-site of the SU, possibly acting as a molecular 
?placeholder? for a-tRNA as the initiation proces progreses [38]. Independent of 
the formation of the 43S pre-initiation complex, the mRNA is prepped for SSU 
atachment. Eukaryotic mRNAs interact with eIFs via their 5? end 7-methylguanosine 
(m
7
G) cap and their 3? end poly-adenosine (poly A) tail. The eIF4F complex, 
comprised of eIF4A, eIF4B, eIF4E, and eIF4G, binds to the m
7
G cap via eIF4E [39]. 
eIF4G binds to eIF4E, as wel as to eIF4A and eIF4B, both of which unwind the 5? 
end of the mRNA in an adenosine triphosphate (ATP)-dependent manner [40,41]. 
eIF4G also binds to poly A binding protein (PABP), resulting in circularization of the 
mRNA, enabling increased control of translational expresion via any regulatory 
features in the 3? untranslated region (UTR) of the mRNA [42,43]. eIF1 and eIF1A, 
bound to the SU, induce a conformational change, inducing an open conformation in 
 
 
17 
the mRNA entry channel previously restricted by h18, h34, and the SU protein S3 
[37,44]. This open conformation enables the activated IF:mRNA complex to atach to 
the 43S pre-initiation complex via an eIF4G:eIF3 connection, with the mRNA 
threaded across the neck region of the SU [16,45]. This molecular amalgamation is 
termed the 48S complex. Within this 48S complex the anticodon of the Met-tRNA
Met
i
 
is not yet positioned entirely in the SU P-site, but exists at an angle, with its Met 
amino acid likely positioned toward the E-site [46,47,48]. Upon binding of mRNA to 
the SU, eIF1 and eIF1A direct scanning of the 48S preinitiation complex in a 5? to 
3? direction along the mRNA in an ATP dependent manner until an AUG start codon 
in a favorable conformation is recognized [49,50]. At this point the Met-tRNA
Met
i
 
anticodon asociates with the AUG codon, triggering eIF2 and eIF5 to hydrolyze 
GTP, and enabling the disociation of eIF2:GDP. This is followed by the disociation 
of the remaining eIFs except for eIF1A, preceding or in response to 60S subunit 
asociation. 60S subunits are joined to the 40S with the asistance of eIF5B:GTP 
[51,52,53]. Hydrolysis of GTP upon subunit joining enables disociation of 
eIF5B:GDP along with eIF1A [54]. At this point initiation is complete, resulting in an 
80S particle positioned at the AUG start codon of an mRNA with the Met-tRNA
Met
i
 
positioned in the P/P site and empty E and A sites.  
 
 
 
18 
 
Figure 6. Ribosomal initiation schematic. 
Schematic depicts the canonical pathway of initiation in eukaryotes highlighting translational factors 
associated with initiation and order of complex formations. Figure is from [37]. 
 
 
 
19 
 While the majority of eukaryotic mRNAs posses 5? m
7
G caps and 3? polyA 
tails, there are a number of examples where cap-les mRNAs (usualy of viral origin) 
are stil translated by eukaryotic ribosomes. These mRNAs posses strong secondary 
structures coded into their 5? UTRs caled internal ribosome entry sites (IRESs). 
Figure 7 depicts several of the more common varieties found in eukaryotes. There are 
almost no set rules for IRES mediated translation initiation. Both the size and shape 
of the IRES is variable from system to system. Similarly, eIFs and Met-tRNA
Met
i
 are 
required for some IRESs, but not others, as is the case with viraly supplied initiation 
factors [55,56]. In the case of the Cricket Paralysis Virus IRES, ribosomes are loaded 
onto the mRNA via the IRES without any viral or eIFs [57]. IRES mediated 
translation ultimately alows for a bypasing of the canonical eukaryotic initiation 
procedure, and remains an area of intense research.  
 
 
 
20 
 
Figure 7. IRES-mediated initiation. 
Examples of diferent IRES elements and their unique means of initiating translation. Each IRES 
forms a different structure, though most have a resemblance to a tRNA molecule. Aditionaly, each 
has a diferent set of initiation factors or lack thereof needed for initiation. Figure is from [37].  
 
Elongation 
 Elongation begins with the selection of the first tRNA to enter the A-site of 
the ribosome, and concludes with the decoding of a stop codon in the A-site. 
Elongation is the proces by which the ribosome proceds along the mRNA in the 3? 
direction one codon at a time, ataching new amino acids to the growing polypeptide 
chain. The elongation cycle has three major steps: acommodation of a cognate 
aminoacyl-tRNA (aa-tRNA), peptidyl transfer, and translocation. Each of these 
events is a multistep proces. 
 
 
21 
 
Aminoacyl-tRNA selection and accommodation 
 Acommodation itself is subdivided into six discrete steps of: 1) initial 
binding, 2) codon recognition or rejection 3) GTPase activation, 4) GTP hydrolysis, 
5) elongation factor conformational change, and 6) acommodation or rejection of the 
aa-tRNA. This pathway is modeled in Figure 8. In the first step, a ternary complex 
composed of an a-tRNA bound to both eukaryotic elongation factor 1A (eEF1A) 
(EF-Tu in Bacteria and Archaea) and GTP is delivered to the A/T site of the 80S 
ribosome. The anticodon of the a-tRNA is positioned in the A-site of the DC while 
the rest of the tRNA adopts a distorted shape, bending betwen the anticodon and D-
loop regions, and positioning its aminoacylated end outside of the A-site of the LSU 
in the T-site [4]. This torsional distortion of the a-tRNA is conserved for both 
cognate and near-cognate tRNAs, and likely instils an energy-potential to the ternary 
complex, as would exist upon the bending of a taught spring [58]. The level of 
complementarity in the Watson-Crick base pairings betwen the anticodon of the a-
tRNA and the codon of the mRNA dictate the initial aceptance or rejection of the a-
tRNA prior to the next step of acommodation. This results in the quick rejection of 
non-cognate tRNA species, vastly reducing the number of incorrect tRNA molecules 
atempting to bind to the ribosome. This screening represents the first of two checks 
to confirm the correct tRNA is bound to the ribosome. Upon acurate tRNA selection, 
18S bases A1492 and A1493 of h44 and also G530 of h18 (E. coli numbering) 
(A1755, A1756, and G577 in yeast respectively) flip out from their syn state to an 
anti conformation, stabilizing the a-tRNA [59]. This stabilization causes further 
 
 
22 
torsion in the a-tRNA, signaling the LSU?s GTPase-asociated center and eEF1A, 
and with the help of SU protein S12 (S13 in yeast), activating eEF1A?s GTPase 
activity, and hydrolyzing GTP [11,60,61]. GTP hydrolysis is followed by a 
conformational change in eEF1A and the rapid disociation of both eEF1A and GDP 
and the aa-tRNA flips into the LSU A-site.  
 
 
Figure 8. Kinetic schematic of aa-tRNA selection and acomodation. 
k
1
-k
7
 depict rate constants, depicted as arows. Red arrows depict slowed rates relative to the black 
arrows, and gren are acelerated rates. k
4
 (missing from figure) is the rate of eEF1A:GDP 
conformational change post GTP hydrolysis and prior to ful accommodation or tRNA rejection. 
Figure is adapted from [60]. 
 
During initial ternary complex selection, near-cognate a-tRNAs disociate at 
a much faster rate, while eEF1A activation and GTP hydrolysis rates are slowed 
significantly relative to cognate a-tRNAs, helping to improve translational fidelity 
[3,62,63]. This leads to the second stage of selection, known as proofreading. Here, 
les is understood, but it is hypothesized that an induced-fit mechanism promotes 
binding of cognate a-tRNAs, while near or non-cognate a-tRNAs are rejected 
(reviewed in [3]). In this model, the incoming a-tRNA pivots around its anticodon 
 
 
23 
stem loop (ASL) through a narrow acommodation corridor which has closed-in due 
to stabilization of the codon/anticodon interactions. It is hypothesized that near-
cognate a-tRNAs do not properly traverse the acommodation corridor due to 
incomplete anchoring of their ASLs in the DC, which in part leads to sub-optimal 
acommodation corridor structure, ultimately leading to disociation of near-cognate 
aa-tRNA species [60].  
 
Peptidyl Transfer 
 Upon acommodation, the a-tRNA positions itself fully in the A-site of both 
the large and smal subunits, with the 3? CCA-aminoacyl end of the a-tRNA in the 
PTC of the 60S subunit. The PTC is the catalytic core of the ribosome and is 
composed entirely of RNA [64,65], with the nearest proteins at least 18? away [66], 
making the ribosome a ribozyme [67]. Once positioned, the ribosome catalyzes the 
peptidyl transfer reaction betwen the !-amino group of the a-tRNA and the ester 
linkage group of the peptidyl-tRNA. The peptidyl transfer reaction is nearly 
instantaneous, occurring in the span of 50 ms [68]. Although the exact mechanism of 
peptide bond formation is not yet fully understood, the leading hypothesis is the 
induced-fit model involving yeast 25S rRNA nucleotides U2875 and G2952-U2954 
(E. coli numbering U2506 and G2583-U2585 respectively). By this model, binding of 
the a-tRNA induces a conformational change in these nucleotides, positioning the C-
terminal amino acid group of the peptidyl-tRNA, making it acesible to nucleophilic 
atack by the aminoacyl group of the A-site tRNA [69]. Peptidyl transfer results in a 
 
 
24 
deacylated tRNA in the P-site, with the growing peptidyl chain now atached to the 
A-site tRNA. 
 
Translocation 
 In order to continue the elongation proces, the ribosome needs to proced in 
the 3? direction along the mRNA by 3 nucleotides (1 codon). Acompanying this 
movement, the A-site must be cleared for the next ternary complex to bind, and the 
tRNA species already bound to the P- and A-sites must proced to the E- and P-sites 
respectively. This proces is termed ?translocation,? and is controlled by a ratcheting 
back-and-forth motion of the SU relative to the LSU, fueled by the GTP hydrolysis 
of eukaryotic elongation factor 2 (eEF2) (EF-G in Bacteria and Archaea). Many 
studies comprising data from chemical protection analyses, X-ray crystal structures, 
cryo-EM, and FRET have aided in elucidating the steps of this proces. 
 Immediately following peptidyl transfer, the clasicaly positioned P/P- and 
A/A-site tRNAs (nomenclature refers to the tRNA?s position in the SU/LSU) shift to 
a hybrid state configuration (P/E and A/P state respectively). This motion advances in 
coordination with a ratcheting movement of the SU, rotating roughly 5-6? in a 
counterclockwise motion relative to the LSU as observed from the solvent side of the 
SSU [1,17,70]. This new state is termed either the ?hybrid state,? or the ?ratcheted 
state.? Figure 9 depicts the relative positions of the tRNA molecules in their pre-
acommodation, clasical, and hybrid states. While movement of the P-site tRNA into 
the hybrid P/E state involves a large motion of the D-loop, T-loop, and the CCA end, 
the adoption of the hybrid state of the A-site tRNA is a smaler movement, consisting 
 
 
25 
merely of a shifting of the CCA end into the P-site [3]. In the ratcheting of the SU, 
the head region is the most mobile element, rotating at the neck relative to the rest of 
the SU by up to 14?, causing a corresponding movement of up to 25? in the head 
region [1]. This SU rotation has litle efect on the intersubunit bridges centraly 
located on the ribosome, but has significant impact on many of the peripheral 
interactions, particularly those in the head of the SU and CP of the LSU. While the 
SU makes the largest structural adjustments during ratcheting, the CP makes 
changes to its form as wel, adjusting the tilt of 5S rRNA, moving protein L5 (L18 in 
Bacteria and Archaea) by 7?, and shifting the position of L11 (L5 in bacteria and 
archaea) [1]. This CP/head movement reconfigures the intersubunit B1b/c bridge, 
made up of proteins S18 (S13 in Bacteria and Archaea) in the head of the SU and 
L11 in the CP of the LSU [1,15,17,70]. Additionaly, this head movement 
reconfigures the B1a bridge, comprised of H38 (also caled the A-site Finger) and 
SU protein S18 in the clasical state, into an altered configuration of H38 and S15 
(S19 in Bacteria and Archaea) in the ratcheted state [1,70]. Intersubunit bridges 
positioned in the intermediate region betwen the periphery and the central axis of 
SU rotation tend to maintain their contacts, though often bending to do so, as has 
been observed in the eukaryotic ribosome with the distortion of H69 to maintain the 
B2a bridge. Bridges located in the central interior of the ribosome are les afected by 
the ratcheting movement, as it has been observed that bridges B2b, B2c, and B3 have 
litle or no visible changes in structure comparing pre- to post-ratchet states [1,71]. 
Thus, the ratcheting motion weakens and rearranges several bridges while stil 
maintaining a close asociation betwen the large and smal subunits. These 
 
 
26 
adjustments likely alow pasage of the mRNA and tRNAs through the ribosome, as 
wel as convey translational status information betwen the large and smal subunits 
of the ribosome. 
 
 
Figure 9. Position of tRNAs in diferent sites of the ribosome. 
tRNAs positions during pre-accomodation (A/T), accomodated/classical state (A/, P/P, E/E), and 
ratcheted state (A/P, P/E). Image was generated by fiting cryo-EM densities with the X-ray resolved 
structures of tRNA molecules using real-space refinement. This figure is from [3]. 
 
Adoption of the hybrid state is only possible after deacylation of the P-site 
tRNA [7], likely due to a removal of the anchoring efect the growing polypeptide 
chain, positioned in the exit tunnel of the ribosome, had previously had on the 
position of the P-site tRNA. Additionaly, with the atachment of the polypeptide 
chain to the A-site tRNA, its CCA end is pulled slightly towards the LSU P-site. 
Work has shown that the peptidyl-tRNA now in the A/P orientation is untenable as a 
peptidyl donor, and it must adopt the ful P/P configuration for elongation to proced 
 
 
27 
[72,73]. Single-molecule FRET studies have revealed the P-site tRNA is capable of 
oscilating betwen the clasical (P/P) and hybrid (P/E) states prior to the ratcheting 
of the SU [10,74], however the ratcheting of the SU appears to stabilize the hybrid 
state of the tRNAs. This conformational adjustment concludes the first half of 
translocation wherein the ribosome has moved the tRNAs across the LSU.  
In the second half of translocation the SU ratchets back to its original 
clasical state, and in doing so shifts frame by one codon, transferring the tRNAs 
from the SU P- and A-sites to the E- and P-sites respectively. While this 
translocation event is capable of proceding without any trans-acting factor 
asistance, the rate of such an event is extremely slow [6,7,75]. Under normal 
conditions, this proces is acelerated by the GTPase factor eEF2. eEF2 appears to be 
a molecular miic of the a-tRNA/eEF1A/GTP ternary complex, and while the SRL 
of the 25S rRNA is a critical player in the binding of eEF2:GTP, numerous cryo-EM 
studies have shown eEF2:GTP communicating with both the large and smal subunits 
[6,76]. Upon binding of the eEF2:GTP complex, hydrolysis of GTP promotes a 
reverse ratcheting of the smal subunit back to its clasical configuration. Concurrent 
with this clockwise rotation of the SU, the tRNAs move from the SU P- and A 
sites into the E- and P-sites respectively as the ribosome simultaneously moves along 
the mRNA by 1 codon. This positions the tRNAs in the E/E and P/P sites, with an 
empty A-site, primed with the next codon, and ready for the appropriate ternary 
complex.  
Thus, peptidyl transfer unlocks the ribosome, and in the first half of 
translocation, the mRNA and tRNAs are held in position on the SU, while ratcheting 
 
 
28 
displaces the tRNAs across the LSU. In the second half of translocation the tRNAs 
are held in position on the LSU, and GTP hydrolysis reverses the ratcheting, 
displacing the mRNA and tRNAs across the SU. eEF2:GDP then disociates from 
the post-translocation ribosome. The exact mechanism by which eEF2 drives forward 
the translocation proces is unclear, but several factors may be involved. An 
observation that eEF2:GTP resembles the ternary complex suggests binding of the 
elongation factor may displace the ASL of the A-site tRNA and shift it towards the P-
site [5,77,78]. GTP hydrolysis further changes the structure of eEF2 [79], increasing 
the flexibility of the head of the SU [5]. This increased head flexibility appears to 
open a gate made up of 18S (16S) nucleotides G1338-U1341 and A790 (E. coli 
numbering) which, when closed prior to eEF2 binding, restricts pasage of P-site 
tRNA to the E-site on the SU [3,15,79]. Translocation concludes with the ribosome 
in the un-ratcheted state, with a deacylated tRNA in the E/E site, a peptidyl-tRNA in 
the P/P site, and an empty A-site. The E-site tRNA is kicked out of the ribosome upon 
the acommodation of a ternary complex binding to the A-site.  
 
Termination 
 An elongating ribosome enters the termination stage when it encounters one 
of three stop codons (UGA, UAG, and UA, also caled nonsense codons) in the A-
site of the SU DC. Termination difers betwen the eukaryotic system and the 
bacterial or archaeal systems, and the focus here wil be on the eukaryotic system. In 
eukaryotes, al three of these codons are recognized by the clas 1 eukaryotic release 
factor (eRF1). eRF1 is responsible for recognizing the termination codon in the A-site 
 
 
29 
and binding to the ribosome. Figure 10 depicts the domain structure of eRF1. Prior to 
binding to the ribosome, eRF1 forms a complex with the clas 2 eukaryotic release 
factor eRF3 via both proteins? C domains [80,81]. eRF3 is a GTPase activating 
protein and is bound to GTP along with eRF1. As observed with the elongation 
factors, the eRF1:eRF3:GTP complex displays a level of molecular miicry with the 
aa-tRNA ternary complex (Figure 11), suggesting that it makes use of similar 
mechanisms to bind the ribosome [82,83,84,85]. Much like the ternary complex, 
eRF1:eRF3:GTP binds to the A-site pocket of the ribosome with the N-domain of 
eRF1 positioned in the DC. While the exact mechanism of stop codon recognition is 
unclear, the presence of a highly conserved Asparagine-isoleucine-lysine-serine 
(NIKS) amino acid sequence in the N-domain of eRF1 is likely a contributing player 
in acurate termination codon recognition and/or eRF1 positioning [86]. However, 
numerous studies have shown that no one linear sequence of eRF1 amino acids can 
fully acount for termination codon recognition, and it likely involves a redundant 
combination of factors [87,88,89,90,91]. 
 
 
Figure 10. Structural map of eRF1 domains. 
Domains N, M, and C are labeled. Vertical arow indicates eRF3 interacting region. NIKS and GQ 
represent highly conserved amino acids. Figure is adapted from [92]. 
 
 
 
30 
 
 
Figure 11. Molecular miicry betwen eRF1 and tRNA. 
 (A) The eRF1 molecule, with the eRF3-binding domain shown in gren, adopts a similar ?L? shape as 
the tRNA
Phe
 which is shown in (B). Figure is adapted from [86]. 
 
 Upon binding the ribosome, the eRF1:eRF3:GTP complex signals the PTC, 
inducing peptidyl tRNA hydrolysis [93,94,95,96,97]. While the precise mechanism is 
not wel understood, one important player is a conserved Glycine-Glycine-Glutamine 
(GGQ) sequence in the central domain of eRF1, which positions itself in the PTC 
pocket of the A-site. The GQ sequence plays a role similar to that of the CCA end 
of the a-tRNA, and studies have shown that certain mutations within this region 
inactivate the ability of the PTC to hydrolyze the peptidyl-tRNA ester bond [98,99]. 
However, not al mutations abrogate peptide release, as mutating the glutamine to a 
glycine did not alter the rates of peptidyl-tRNA hydrolysis [82,99]. A key diference 
betwen peptidyl transfer in an elongating ribosome and peptide release during 
termination is the required exclusion or presence of water respectively (reviewed in 
[100]). In elongation, the ribosome must prevent water from acesing the PTC in 
 
 
31 
order to prevent nucleophilic atack by the water molecule on the peptide-tRNA ester 
bond, which would result in early termination of translation. In termination, this water 
molecule is required for release of the polypeptide chain from the tRNA and the 
ribosome. Exactly how the eRF1:eRF3:GTP complex provides water acesibility to 
the PTC is unknown. 
 Upon peptide release eRF1 stimulates eRF3 to hydrolyze its GTP. In bacteria, 
this procedure is performed by RF3, and it is required for release of the clas 1 factor 
from the ribosome [101,102], however the same has not yet been established in 
eukaryotes. In fact, litle is understood as to the proces by which GTP hydrolysis is 
activated, nor of its specific function in the eukaryotic termination proces. It is 
however known that eRF3 is an esential protein [86].  
 Following peptide release from the peptidyl-tRNA, the ribosome contains a 
deacylated tRNA in its P/P or P/E site. In bacteria, the ribosome release factor (RRF), 
shaped much like a crowbar, binds at a right angle to the A-site, and with the help of 
initiation factor 3 and EF-G:TP separates the LSU from the SU [103]. No 
equivalent of RRF has been discovered in either Archaea or Eukaryotes. There 
currently exist three dominant models for how eukaryotic ribosomes proced post 
termination. The first involves eIF3 binding to the SU and inducing a 
conformational change that separates the LSU from the SU [104,105]. The second is 
the ?closed-loop model,? wherein the mRNA circularizes and ribosomes go from 
termination straight around to initiation again. This model is supported by work 
demonstrating eRF3 and PABP asociate with each other, thus linking a termination 
factor with an initiation factor [106], and that disruption of this eRF3:PABP 
 
 
32 
interaction inhibits translation, while inclusion of eRF3 in an in vitro translation 
system increased the rate of initiation [107]. The third involves an eRF1:eRF3 
complex and/or a Dom34:Hbs1 protein complex. Dom34 and Hbs1 are both 
evolutionarily similar to eRF1 and eRF3 respectively. One recent study identified 
eRF1:eRF3 as destabilizing ribosomal subunits when a stop codon is present in the A-
site. Similarly, a Dom34:Hbs1 protein complex destabilized ribosomal subunits and 
caused peptidyl release, followed by ribosomal recycling. This efect by the 
Dom34:Hbs1 complex preferentialy targeted malfunctioning/staled ribosomes, 
perhaps directing the products into the nonfunctional ribosome decay pathway upon 
subunit disociation [108]. It is possible, but not yet proven, that each model may 
simultaneously be acurate under certain conditions. Indeed, one recent study has 
indicated eIF3 along with several other factors including eIF1, eIF1A, and eIF3J not 
only disociate the 60S subunit from the 40S, but aid in the release of both deacylated 
P-site tRNA and mRNA, and also asist in ribosome recycling [109]. 
 
Translational Recoding 
 Ribosomal translation usualy begins at a start codon and proceds in-frame 
one codon at a time, terminating at a stop codon. However, translation can proced 
through a variety of non-canonical pathways commonly referred to as ?translational 
recoding.? Some examples of translational recoding include the alteration of the 
reading frame post-initiation, or suppresion of nonsense codons. These recoding 
events are stimulated by cis-acting elements found in the mRNA, influencing a subset 
of translating ribosomes, and resulting in multiple translational outcomes from a 
 
 
33 
single mRNA. Thus, recoding events provide increased informational richnes in a 
condensed genetic space. Acordingly, translational recoding strategies are often 
employed by viruses that are under constant evolutionary presure to pack as much 
information into as smal a genetic frame as possible. An examination of these 
recoding events can offer insights into the mechanics of translation and how 
ribosomes maintain their high levels of fidelity. 
 
Programmed -1 Ribosomal Frameshifting 
 Programed ribosomal frameshifting (PRF) is a non-random recoding event 
where elongating ribosomes are induced to slip out of the traditional reading-frame by 
one nucleotide in either the 5? (-1) or 3? (+1) direction, and then proced with 
elongation. -1 PRF was first identified in the Rous Sarcoma Virus (RSV) [110] and is 
utilized by a wide variety of viruses including Severe Acute Respiratory Syndrome 
(SARS) [111], Human Immunodeficiency Virus type-1 (HIV-1) [112], and Infectious 
Bronchitis Virus (IBV) [113,114]. Mostly found in RNA viruses, -1 PRF has been 
confirmed in a number of other viral families and across multiple kingdoms. More 
recently -1 PRF has been identified in the genes of the eukaryotes yeast [115,116], 
mice [117,118], and humans [119].  
-1 PRF requires the presence of three mRNA cis-acting elements. These 
include a heptameric slippery sequence [112], a downstream obstruction such as a 
stem loop or pseudoknot [120,121,122], and a spacer region connecting these two 
elements [113,121,123]. Figure 12 depicts how viruses make use of -1 PRF and the 
stimulatory signals. The slippery sequence has the form of 5?_X XY YZ_3? (zero-
 
 
34 
frame identified by spacing) with X?s being any three identical nucleotides, Y?s are 
al U or al A, and Z is any nucleotide except G. The ribosome positions itself over 
the slippery sequence such that the P- and A-site tRNAs are matched with the XY 
and YZ positions respectively [124]. A recent examination of the HIV-1 -1 PRF 
slippery site also identified the 3 nucleotides 5? of the slippery site as influencing -
1PRF. These findings were bolstered by similar data derived from other viral slippery 
sites [125]. The importance of these findings wil be expanded upon below. Diferent 
slippery sites are more or les ?slippery? based on the percentage of A/U nucleotides 
which form weaker Watson-Crick base pairing versus the percentage of G/C 
nucleotides which have stronger base pairing and thus reduce the ?slipperines? of the 
slippery site. In al slippery sites, the bases of the mRNA are organized such that a -1 
PRF event wil result in a cognate or near-cognate realignment of codon:anticodon 
interactions. While it is possible for ribosomes to frameshift in the presence of only 
the slippery site, the frequency of such events is very low (0.1-0.2% in mamalian 
cels) [126,127]. The mRNA pseudoknot increases this rate to biological significance 
by forcing the ribosome to pause over the slippery sequence as its helicase struggles 
to unwind the strong structural element [128]. Pseudoknots come in a variety of forms 
as depicted in Figure 13, but typicaly involve a hairpin stem loop with the 
nucleotides at the end of the stem loop sharing Watson-Crick base-paring with other 
downstream nucleotides. These downstream nucleotides sharing in the pseudoknot 
are usualy within 100 bases of the stem loop, but can be in extreme cases, such as the 
barley yelow dwarf virus, separated by upwards of 4 kb from the stem loop [129]. 
The spacer region enables the ribosome to be properly positioned over the slippery 
 
 
35 
site while being held in place by the pseudoknot. Spacer regions are typicaly 5-8 
nucleotides in length depending on the virus, host, and pseudoknot, but have been 
found to be as short as 1 nucleotide in RSV, as reviewed in Table 7.1 (pages 155-156) 
of [130].  
 
 
 
36 
 
Figure 12. Products and anatomy of a -1 PRF signal. 
In the center is a representation of the simian retrovirus type 1 viral mRNA with the structural gag 
protein shown in gray and in the translational ?0? frame, and the enzymatic pol in the ?-1? frame. 
Normaly translation avoids frameshifting (FS) and produces Gag protein (top left of panel). 
Occasionaly a -1 PRF event occurs, producing a Gag-Pol fusion protein. When the corect 
stoichiometric ratio of Gag to Gag-Pol exists, viral particles self asemble, in this case using the host 
cellular membrane (top right of panel). The botom of the panel shows the stimulatory signal. The 
pseudoknot?s 3-dimensional structure is also shown. Stem 1 (S1), red; Loop 1 (L1), purple; Stem 2 
(S2), blue; Lop 3 (L3), green. Figure is adapted from [130].  
 
 
37 
 
Figure 13. Examples of viral mRNA pseudoknots. 
mRNA -1 PRF inducing signals from 6 viruses highlighting pseudoknot diversity. Slippery sites are 
underlined; Stem 1 (S1), red; Loop 1 (L1), purple; Stem 2 (S2), blue; Loop 2 (L2), orange; Loop 3 
(L3), green. Colors correspond to 3-dimensional structure when available. S2 in RSV is not shown as 
paired purely for easy of presentation. Figure is adapted from [130].  
 
 
38 
 
In simplified terms, -1 PRF occurs a certain percentage of the time when the 
ribosome pauses at the pseudoknot, with the slippery site in the ribosome?s DC. This 
results in a slipping of the ribosome backwards by 1 base, at which time the tRNAs 
re-asociate with the mRNA in the new reading frame (often in a near-cognate 
environment). The ribosome eventualy melts out the pseudoknot, and translation 
resumes. While the molecular mechanism of -1 PRF remains elusive, a number of 
models have atempted to acount for the proces. These models are: 1) the 9? 
model, 2) the simultaneous slippage model, 3) the dynamic model, 4) the mechanical 
model, and 5) the three-tRNA model. Each model has unique and overlapping 
features with other models, and occurs at diferent steps of the elongation cycle 
(depicted in Figure 14). 
 
 
 
39 
 
Figure 14. Mechanistic models of -1 PRF. 
Each model exists at a diferent stage of the elongation cycle. E, P, and A site tRNAs are shown in 
black, gren and blue respectively. eEF1A with and without GTP/GDP is shown in red. LSU is dark 
gray, SU is light gray. 0-frame codon:anticodon base pairing are shown as dots, and -1 frame base 
interactions are shown as lines. mRNA tension is depicted as black jagged lines betwen A-site and the 
helicase (shown as a ?no-entry? symbol with arrows circling it). Pseudoknot is black folded mRNA 
structure betwen the helicase and the 3? mRNA end. Figure is from [130]. 
 
 
 
40 
The 9? model [131] is an expansion of the ?integrated model? [132], both 
proposed by members of our laboratory. In this model, -1 PRF occurs during a-
tRNA acommodation. As the ribosome atempts to read through the pseudoknot a 
local tension builds in the mRNA betwen the pseudoknot and the ASL of the 
acommodating a-tRNA. This tension causes the disruption of codon:anticodon base 
pairing, alowing the ribosome (or the mRNA) to slip by 1 nucleotide, decreasing the 
tension, and followed by re-asociation of codons:anticodons. This model acounts 
for mutations in eEF1A afecting -1 PRF [133], as wel as isolation of mutants with 
slower rates of peptidyl transfer having increased rates of -1 PRF [134], suggesting 
frameshifting (FS) takes place prior to peptidyl transfer. However, recently mutations 
in eEF2 have been identified that influence -1 PRF [135], suggesting alternative 
pathways to -1 PRF.  
 The simultaneous slippage model is the oldest explanation and places the 
timing of -1 PRF at post-acommodation, but pre-peptidyl transfer [124]. While 
identifying the A- and P-site slippery codons as critical to the proces, today this 
model remains the most problematic. Encountering the slippery site alone does not 
appear to acount for -1 PRF, and this model proposes no other force spurring the 
reaction forward. It is also unlikely that such a force would have time to extend an 
influence prior to peptidyl transfer, which proceds extremely rapidly. An efort to 
resolve the shortcomings of the simultaneous slippage model is the dynamic model, 
which asigns translocation as the stage of -1 PRF [136,137]. This model atributes 
the dynamic movements of the ribosome as supplying the force required to promote 
 
 
41 
FS, as wel as destabilizing the placements of the tRNAs as they adopt their hybrid 
P/E and A/P states.  
 The mechanical model is a fusion of the 9? model and the dynamic model in 
many ways. Like the 9? model, the mechanical model identifies the tension betwen 
the A-site tRNA and the pseudoknot as the driving force for -1 PRF. Similar to the 
dynamic model, the mechanical model identifies -1 PRF occurring during an 
intermediate state of translocation, after eEF2:GTP hydrolysis, but prior to full 
adoption of the P/P state. Evidence for this model exists in the form of cryo-EM 
studies of ribosomes staled at pseudoknots [138,139]. The model predicts that as the 
A/P tRNA is induced by the ratcheting of the ribosome to adopt the P/P state, the 
tension in the mRNA from the pseudoknot is transferred to the A/P tRNA, causing it 
to bend and ?jump? into the P-site. This ?jump? breaks the codon:anticodon 
connection, alowing for a realignment in the -1 frame, either due to misplacement of 
the tRNA, or by slippage during translocation of the mRNA. However, evidence for 
this model relies on structures lacking a slippery site and P/E or E/E tRNAs, which 
are normaly present in the FS ribosome, raising doubts of the applicability of these 
observations. Additionaly, recent cryo-EM images from Brierley J. et al. have cast 
doubt on the validity of this model as wel (personal communications, Cold Spring 
Harbor Laboratory Translational Control Meting, 9/2010). 
 The three-tRNA model atempts to reconcile many of the findings of the 
previous models. Taking into acount the three nucleotides upstream of the slippery 
sequence which were identified as influential on -1 PRF [125], this model identifies 
the slippery sequence as 5?_A BCX XY YZ_3?. In the first step, P- and A-site 
 
 
42 
tRNAs are paired with BCX and XY respectively. Upon translocation the tRNAs do 
not fully align in the E/E and P/P sites due to instability from interactions with the 
pseudoknot and slippery site. During the next round of acommodation the tRNAs 
slip in a sequential manner into the -1 frame starting with the E-site tRNA. While the 
exact particulars of this proces are stil unclear, this model could acount for 
mutations in eEF1A, eEF2, and the ABC nucleotides al afecting rates of -1 PRF. 
The nature of E-site tRNA interactions with the mRNA are also uncertain and need 
further examination. While elements of each of these models likely contain truths, it 
is entirely possible that none of them fully acount for the mechanics of -1 PRF. At 
the same time, it is also possible that -1 PRF can proced in a variety of pathways as 
described [140], alowing for multiple models to identify acurate mechanics. In this 
study by Liao et. al. -1 PRF pathways were kineticaly modeled and tested using both 
mathematical and in vivo approaches. Three unique pathways were identified, each 
initiating at a diferent point of elongation in relation to the slippery site, but each 
ending with a -1 PRF event. This work showed that alterations in cis-acting elements 
and kinetic parameters can alter both the rate of FS and the mechanism by which -1 
PRF occurs. This underscores the point that multiple routes may be circumstantialy 
employed to reach the critical goal of a -1 PRF event.  
 
Programmed +1 Ribosomal Frameshifting 
 +1 PRF functions in a biologicaly similar manner as -1 PRF, shifting the 
translational reading frame by 1 nucleotide in the 3? direction, resulting in either an 
early termination of the 0-frame product, or bypasing the 0-frame stop codon, 
 
 
43 
producing a larger fusion protein. Active +1 PRF systems have been identified in the 
genes of viruses and transposable elements [141,142,143,144], E. coli [145], yeast 
[146,147,148], and mamals [149]. While the outcome resembles that of -1 PRF, the 
mechanics underlying the proces are distinct. Requirements for eficient +1 PRF to 
occur include a 7-nucleotide slippery site, a near-cognate bound P-site tRNA, and an 
empty A-site with a rare tRNA codon followed by an abundant tRNA codon in the +1 
A-site codon frame.  
A wel characterized example of a +1 PRF system is the retroviral-like Ty1 
retrotransposon which exists in yeast [150]. When translated entirely in the 0-frame, 
the mRNA of Ty1 codes for a gag structural protein, but when a +1 PRF event 
occurs, an overlapping open reading frame (ORF) coding for the enzymatic reverse 
transcriptase pol product is translated, forming a gag-pol fusion protein [151]. FS in 
Ty1 has been measured as 40% eficient [152]. The slippery site of Ty1 was found to 
be CUU AG C (spacing indicates 0-frame) [152], with CUU (leucine) occupying 
the P-site of the DC. For eficient FS to occur, the CUU codon is bound not by the 
cognate a-tRNA
Leu
AAG
, but by the near cognate a-tRNA
Leu
UAG
. This results in weak 
Watson-Crick base pairing, alowing for a wobble in the P-site tRNA. The A-site 
codon AG (arginine) codes for a rare tRNA species, staling the ribosome as it 
awaits delivery of the appropriate tRNA. During this pause, the ribosome can slip 
forward by 1 nucleotide, asisted by the repairing of the P-site tRNA to the UA 
mRNA bases. This newly slipped ribosome:mRNA and or tRNA:mRNA interaction 
is imediately stabilized by the acommodation of the abundant a-tRNA
Gly
GCC
 
species (existing at a 16-fold higher concentration than a-tRNA
Arg
CCU
) which 
 
 
44 
recognizes the +1 GC codon. At this point translation progreses under traditional 
mechanics. In the case of Ty1, a +1 PRF event bypases the UGA 0-frame stop codon 
present 6 codons beyond the slippery site Leu codon. Experiments either supplying a 
cognate a-tRNA
Leu
 to the slippery site, or mutating the slippery site Leu codon to 
provide a cognate pairing reduced FS rates dramaticaly [152]. Similarly, 
overexpresion of a-tRNA
Arg
CCU
 resulted in significant reduction of +1 PRF events 
[152], and deletion of the tRNA
Arg
 increased FS to near 100% [153]. While the 
sequence of the +1 PRF slippery site is variable from instance to instance, the general 
kinetics appear to be conserved. Figure 15 depicts the structure of the Ty1 and Ty3 +1 
PRF signals. 
 
 
 
45 
 
Figure 15. Gene layout and +1 PRF signal of Ty1 and Ty3. 
Example of two diferent +1 PRF signals in yeast. (A) Ty1 gene layout and FS signal region. Slipery 
site highlighted in purple, 0 Frame stop codon is underlined in red. (B) Ty3 layout as shown in (A). 
Blue highlighted bases mark stimulatory signal. (C) sequence comparison of Ty1 and Ty3. Figure is 
adapted from [154]. 
 
Unlike -1 PRF, +1 PRF is known to be regulated by trans-acting factors in 
some cases. An example is the prfB gene in E. coli that encodes release factor 2 (RF2) 
[145]. In this case the slippery site A-site arginine codon is replaced by the stop 
codon UGA, which is recognized by RF2. When enough RF2 is present in the cel the 
stop codon is recognized and translation is halted. When the cel needs to produce 
more RF2 the ribosome wil pause at the stop codon, and then slip into the +1 frame, 
 
 
46 
completing translation and producing more RF2. Overexpresion of RF2 has been 
shown to reduce FS, while supplying the cel with defective mutant RF2 increases +1 
PRF to near 100% eficiency [145,155]. Thus, RF2 acts as a self-regulating 
transacting factor on +1 PRF.  
While few examples of +1 PRF have been identified in higher eukaryotes, the 
production of al known antizymes relies on such FS events [156]. Antizymes are 
enzymes from a single gene family which target the enzyme ornithine decarboxylase 
(ODC). In eukaryotes ODC is required for polyamine biosynthesis, converting 
ornithine into putrescine [157]. Putrescine is then made into the polyamines 
spermidine and spermine by spermidine synthase and spermine synthase respectively. 
ODC activity is suppresed by ODC antizyme, which binds to ODC dimers, splits the 
ODC dimer, and targets the subunits for degradation, thus inhibiting production of 
polyamines [158]. Active ODC antizyme is only produced by a +1 PRF event 
controlled by a fedback loop [158,159]. When concentrations of polyamines are low, 
ribosomes avoid the +1 PRF, but as concentrations of polyamines rise, so too does +1 
PRF, resulting in active ODC antizyme production, and down-regulation of ODC and 
decreased production of polyamines [160,161].  
 
Misense and Nonsense Supresion 
 The ribosome has evolved to translate mRNAs with both speed and acuracy. 
Mutations afecting translational fidelity can be examined to beter understand the 
mechanics of the ribosome. Two aspects of translational fidelity thus utilized in this 
work are misense suppresion (the rate at which near or non-cognate tRNAs are 
 
 
47 
mistakenly acommodated, and their amino acids incorporated into the growing 
polypeptide chain), and nonsense suppresion (the rate at which stop codons are 
translated by a suppresor tRNA, reading through the codon). Each of these recoding 
events are afected by the acuracy of the ribosome, and particularly in the case of 
nonsense suppresion can have dramatic efects for protein synthesis. As is the case 
with most forms of translational recoding, nonsense suppresion is found to be a 
translational strategy in a number of viruses, often used to produce gag-pol fusion 
proteins as is sen with PRF [162,163,164]. Cis-acting elements such as mRNA 
pseudoknots [165], or whether the base 3? of the stop codon is a ?C? [166], can 
increase the rate of nonsense suppresion. Alternatively, stop codons UAG and UGA 
can be redefined by a modified a-tRNA such as a pyrrolysine or selenocysteine 
respectively, as has been documented in a group of methanogenic archaea [167,168]. 
However, in the context of this thesis, both misense and nonsense suppresion are 
examined as recoding errors, and not as broader translational strategies. 
  
Scope of Work 
 The work presented in this thesis focuses on the esential LSU ribosomal 
protein L11 (L5 in Bacteria and Archaea). L11 is located at the intersubunit cleft of 
the CP of the LSU, forming contacts with the T-loop of the peptidyl-tRNA, Helix 84 
of the 25S rRNA, helix III and loop C of the 5S rRNA, and SU protein S18 (S13 in 
Bacteria and Archaea) in the form of the B1b/c intersubunit bridge. Due to L11?s 
esential nature, its close proximity to the LSU?s P-site, and its involvement in a 
dynamic bridge comprising the only protein-protein intersubunit connection, L11 is 
 
 
48 
likely involved in an intersubunit communication network, making it an ideal target 
for further study. A reverse genetics approach was employed, generating a series of 
mutations targeting the P-site tRNA interacting region, the B1b/c bridge region, and 
the central core/H84 interacting region of L11. Mutants were screened for phenotypic 
abnormalities using a series of genetic and functional asays. Mutants with unique 
characteristics were examined further using biochemical and structural analyses. 
Chapter 2 focuses on L11?s role as a molecular sensor of the occupancy status of the 
P-site binding pocket. Chapter 3 addreses L11?s role in mediating ribosome 
ratcheting via the B1b/c bridge, identifying an extensive network of information flow 
betwen the large and smal subunits. Chapter 4 explores the role of L11 in subunit 
joining and biogenesis. Chapter 5 summarizes and discusses these findings, and 
highlights avenues for further investigation.  
 
 
 
49 
Chapter 2 
A flexible lop in yeast ribosomal protein L11 cordinates P-site 
tRNA binding 
Introduction 
Over the past decade, atomic resolution ribosome structures have revealed the 
locations of critical elements in various translational states. However, these static 
images do not reveal the dynamic movements within this complex macromolecule. 
The ribosome must coordinate multiple activities betwen spatialy and functionaly 
diferent sites in two subunits. These include three tRNA binding sites, the peptidyl 
transferase and decoding centers, and the elongation factor interacting regions. Events 
occurring in these regions must be carefully coordinated to asure rapid and acurate 
decoding of mRNAs. Current eforts in the field are focusing on determining the 
mechanisms by which these functional centers synchronize their actions and 
communicate with each other.  
The eukaryotic ribosome contains nearly 80 intrinsic proteins. The high 
degree of similarity across species, from the primary amino acid sequences to their 
tertiary structures, suggests conserved functional roles beyond serving as mere 
scafolding for the rRNAs. Ribosomal protein L11 of Saccharomyces cerevisiae is an 
esential, highly conserved component of the 60S subunit (in Bacteria and Archaea, 
the homologous protein is named L5: the yeast nomenclature is used throughout this 
text to minimize confusion). At the primary amino acid sequence level, L11 is wel 
conserved among eukaryotes (~67% - 97% identity), while bacterial and archaeal L5 
proteins are les wel conserved (27% - 55% identical with eukaryotes) (se Figure 
 
 
50 
16). L11 is uniquely positioned at the interface betwen the LSU CP (Figure 17A and 
Figure 17B) and the head of the SSU [9,12,15,64,65]. In the SSU, the head region 
undergoes significant rotational movement relative to the CP betwen the pre- and 
post-translocational states [17], and the protein-protein interactions betwen L11 and 
S18 (S13 in Bacteria and Archaea) on the SSU (the B1b and B1c intersubunit 
bridges) undergo the largest intersubunit structural rearrangements betwen these two 
states [7,8,169]. These observations suggest that L11 may play a central role as an 
informational conduit betwen the two subunits. Detailed analysis of the X-ray 
crystalographic and cryo-EM structures (Figure 17B) reveals that the concave 
surface of the beta sheet portion of L11 interacts with specific nucleotides in the 
minor groove of 23S rRNA helix 84 [170]. L11 also makes contacts with the helix III 
and loop C regions of 5S rRNA; these connections have been hypothesized to help 
stabilize 5S rRNA interactions and may participate in an information signal 
transmision network linking functional centers within the ribosome [64,171]. 
Importantly, the B1b and B1c intersubunit bridges with S18 are the only protein-
protein interactions betwen the two subunits [9,15,65,169]. Analyses of these 
structures indicate that contacts involving L11 and S18 through the B1b and B1c 
bridges break and rearrange after eEF-2 binding and ribosome ratcheting, controlled 
in part by oppositely charged amino acid side chains betwen the two proteins 
[5,7,8,12,15,65]. An internal loop of L11 that we denote the ?L11 P-site loop,? which 
is roughly formed by amino acid residues 48-68, also directly contacts the T-loop of 
the peptidyl-tRNA in the P-site through tRNA nucleotide 56 [9,12,65]. At the level of 
primary amino acid sequence, the P-site loop is highly conserved among eukaryotes 
 
 
51 
(85% - 100% identity), while it is les wel conserved among bacterial and archaeal 
species (42% - 57% identity with eukaryotes) (Figure 18). At the biochemical level 
however, the P-site loop is significantly more homogeneous, containing a large 
number of wel aligned charged and aromatic amino acids. In particular, A50, F57, 
R60, and I65 (yeast numbering) are universaly conserved. An alignment of the P-site 
loop structures from yeast, H. marismortui, T. thermophilus and E. coli reveals that 
the P-site loop is extremely wel conserved at the structural level (Figure 19).  
 
 
 
 
52 
 
Figure 16. Multiple sequence alignment of L1. 
(A) CLUSTAL 2.0.12 multiple sequence alignment of eukaryotic L1 and bacterial/archaeal L5 
proteins. Red: smal amino acids (a); blue: acidic a; magenta: basic a; gren: hydroxyl, amine, 
basic, Q. (B) Percent identity breakdown of multiple sequence alignment from (A). 
 
 
 
53 
 
Figure 17. Localization of L1 within the ribosome. 
(A) Image of the yeast ribosome. The LSU is colored gren, and the SSU is pink. L11 (cyan) is located 
in the CP of the LSU wher it interacts with 5S rRNA, Helix 84 of 25S rRNA, the T-loop of the 
peptidyl-tRNA, and the SSU protein S18 via the B1b and B1c intersubunit bridges. (B) Close-up view 
of L11 and neighboring structures. Amino acids of L11?s P-site lop targeted for mutation (R51-R61) 
are colored deep blue. (C) L1 P-site lop amino acids, mutations analyzed in the curent study, and 
their viabilities as the sole form of L1. Y52* represents multiple mutations: !, A, R, E, S, I, Q, N, H, 
and F. Ribosomal structures generated in PyMol using yeast cryo-EM [12] with tRNAs from T. 
thermophilus [65]. tRNAs wer docked to ribosome using rpS18 as an ?anchor? in a tRNAs+S18 
object using S18 alignment feature of PyMol. T. thermophilus S18 was then hiden for purposes of 
image generation. 
 
 
 
54 
 
 
Figure 18. Multiple sequence alignment of L1 P-site lops. 
(A) CLUSTAL 2.0.12 multiple sequence alignment of eukaryotic L1 and bacterial/archaeal L5 P-site 
loops. Red: smal amino acids (a); blue: acidic a; magenta: basic a; gren: hydroxyl, amine, basic, 
Q. (B) Percent identity breakdown of multiple sequence alignment from (A). 
 
 
55 
 
Figure 19. L11 structural conservation acros species with focus on the P-site lop. 
PyMol image of ribosomal elements include structural alignments of L1 from S. cerevisiae (cyan) 
[12], H. marismortui (red) [170], and L5 proteins from T. thermophilus (gren) [172], and E. coli 
(blue) [15]. tRNAs from [65] are modeled into the image using the same method as was employed for 
Figure 17. 
 
In yeast, L11 is encoded by the paralogous genes RPL11A and RPL11B 
located on chromosomes 16 and 7 respectively [173]. The 19-kilodalton proteins are 
174 amino acids long and are identical except for an alanine (L11A) to threonine 
(L11B) diference at the third amino acid position. Analysis of L11 in the late 1980?s 
(A.k.a. L16 due to inconsistent ribosomal protein visualization techniques using 2D 
electrophoresis and subsequent naming discrepancies. These discrepancies were later 
resolved and names were standardized, resulting in the final protein name of L11.) 
showed that expresion of either isoform was sufficient for cel viability [174]. 
 
 
56 
However, when expresed as the sole form of L11, RPL11A mRNA transcripts 
acumulated to only 33% - 40% of wild-type levels as compared to cels expresing 
both isogenes, while RPL11B mRNAs acumulated to 60% ? 66%. Expresion of 
either isogene alone also afected 60S subunit asembly: a strain expresing only 
L11B grew at wild-type rates but synthesized fewer 60S subunits than wild-type cels 
(although apparently not below a threshold necesary for wild-type growth rates), 
while strains expresing only L11A grew more slowly than wild-type, and 
synthesized only 3-40% of wild-type levels of total L11 and 60S subunits [174]. It 
was shown in this same study the growth diferences were due entirely to disparate 
expresion levels of the L11 isoforms, and not due to any inherent discrepancy 
betwen L11A and L11B function. A random mutagenesis screen of RPL11B for cold 
sensitive mutants identified aleles that promoted 25S pre-rRNA procesing and 
initiation defects [175]. The specific mutants identified in that study were S34P, 
S41P, S97F, A98V, S119C, and G135D. In Arabidopsis, divergent 5?UTRs betwen 
the two isogenes was found to result in diferential expresion among plant tisues 
[176]. In addition to its function as a ribosomal protein, L11 has been implicated in 
p53 activation through its interactions with HDM2 in the nucleus of human fibroblast 
cells [177], and mutant forms of L11 have been linked to Daimond-Blackfan anemia 
in humans [178]. 
Although the structural information suggests that L11 should play a 
significant role in translation, functional analyses of the protein in this role have not 
been performed. In this report, a series of mutants were generated using a reverse 
genetics approach to parse the role of the L11 P-site loop. Analyses focused on two 
 
 
57 
multi-amino acid mutants with opposing efects on rRNA structure and tRNA 
binding. We propose that prior to peptidyl transfer, the presence of peptidyl-tRNA in 
the LSU P-site positions the L11 P-site loop to interact with the Helix 84 of the LSU 
rRNA. After peptidyl transfer, spontaneous translocation of the deacylated tRNA to 
the LSU E-site alows the L11 P-site loop to extend into the P-site, breaking contact 
with Helix 84 and altering H84?s conformation. By this model, we hypothesize that 
the L11 P-site loop functions localy as a sensor of the occupancy status of the 
ribosomal P-site.  
 
Materials and Methods 
Strains, plasmids, and media 
Restriction enzymes were obtained from Promega (Madison, WI), MBI 
Fermentas (Vilnius, Lithuania) and Roche Applied Science (Indianapolis, IN). The 
QuikChange XL II site-directed specific mutagenesis kit was purchased from 
Stratagene (La Jolla, CA). DNA sequencing was performed by Genewiz 
(Germantown, MD). E. coli DH5! was used to amplify plasmid DNA. 
Transformation of yeast and E. coli and were performed as previously described 
[179]. YPAD, SD, and 4.7 MB plates for testing the kiler phenotype were as 
previously reported [179]. Plasmids for expresion of dual luciferase reporters were 
described previously [180].  
S. cerevisiae strain PSY2088 (MAT! rpl11a::HIS3 rpl11b::HIS3 ura3-52 
leu2"1 trp1"63 his3"200 + YCpL11B URA3), an rpl11a/rpl11b gene deletion strain 
in which L11 is supplied by a URA3-CEN6 based RPL11B clone, was a generous gift 
 
 
58 
from Dr. Pamela Silver [181]. The L-A and M
1
 viruses were introduced into 
PSY2088 by cytoplasmic mixing (cytoduction) through nonproductive mating with 
JD758 (MATa kar1-1 arg1 [L-AHN M
1
]) to produce the Kiler
+
 strain JD1313 as 
previously described [179]. Wild-type RPL11B was isolated from yeast strain 
PSY2088 plasmid (pYCP50L11B URA3). Using flanking Bam H1 restriction sites, a 
2.2 kB fragment of DNA containing both the 525 bp wild-type RPL11B ORF plus 
the native 5? and 3? UTR regions (1228 bp and 485 bp respectively) was purified by 
agarose gel electrophoresis. This 2238 bp fragment was ligated into Bam HI digested 
pRS314, a low copy TRP1-selectable plasmid (purchased from ATCC, Manasas, 
VA) [182] to create pRS314L11B-TRP1. A map of this plasmid is shown in Figure 
20. This plasmid served as the template for generation of rpl11B mutants by site 
directed mutagenesis using the primers listed in Appendix C, Table 7. Wild-type and 
mutant pRS314L11B-TRP1 clones were transformed into JD1313, selected for 
growth on SC?trp medium, and cels having lost the URA3-based plasmid were 
identified by their ability to grow in the presence of 5-fluoroorotic acid (5-FOA) 
[183].  
 
 
 
59 
 
Figure 20. Map for wild-type L1B plasmid. 
 
Cel growth and drug resistance/sensitivity phenotypes 
The efects of temperature and translational inhibitors were asesed by standard 10-
fold dilution spot asays. Yeast were grown in H?tryptophan synthetic deletion media 
(-Trp) to mid log phase. OD
595
 values were obtained, and cels were serialy diluted 
10-fold from 10
5
 to 1 CFU per 2.2 ?L and spotted on ?Trp plates. Growth was 
monitored at 20? C, 30? C and 37? C, and pharmacogenetic asays utilized 2mg/ml 
paromomycin, 40 ?g/ ml anisomycin, or 30 ?g/ml sparsomycin incubated at 30? C for 
3-5 days. Kiler virus asays were performed as previously described [179].  
 
Translational Fidelity Asays 
The dual luciferase reporter plasmids pYDL-control, pYDL-LA, pYDL-Ty1, 
pYDL-UAA [180] and pYDL-AGC
218
 [184] were employed to quantitatively monitor 
-1 PRF, +1 PRF, suppresion of a UA codon, and suppresion of an AGC serine 
 
 
60 
codon in place of an AGA arginine codon in the firefly luciferase catalytic site 
respectively. In this study, the reporters were housed in LEU2-based reporters: the 0 
frame dual luciferase reporter was pJD419, the L-A double stranded RNA (dsRNA) 
virus -1 PRF containing reporter was pJD420, and the Ty1 containing +1 PRF 
reporter was pJD421. Figure X depicts the dual luciferase system and reporter 
plasmids. 
 
 
Figure 21. Dual luciferase system. 
Control and test plasmids are transformed into yeast and cels are grown at 30? C. Control plasmid 
produces a Renila-firefly fusion protein. Test plasmid produce a working Renila protein with an 
inactive firefly protein, unles the specific translational recoding event has ocured. A ratio of ratios 
yields the % eficiency of each recoding event being screned for. 
 
 Cels were grown overnight in 5 ml volumes of ?leu synthetic depletion 
media to mid log phase (A
595
 = 0.8-1.5). Cels were washed, resuspended in lysis 
buffer (1X PBS pH 7.4, 1 mM Phenylmethylsulfonyl fluoride (PMSF)) and lysed 
using 0.5 m glas beads with a vortex mixer for 3-5 minutes at 4? C. Lysates were 
clarified by centrifugation for 5 minutes at 8000 rpm in a bench top microcentrifuge 
 
 
61 
at 4? C. Samples were maintained on ice, and 5 ?l of clarified lysate was added to 50 
?l of pre-aliquoted Promega LARII reagent, mixed by pipeting, and read in a 
TD20/20 luminometer. Immediately upon completion of this reading, 50 ?l of 
Promega Stop and Glo buffer was added to the tube, pipeted to mix, and read again. 
This was repeated 6-12 times per strain per reporter depending on the consistency of 
the data, with wild type values for both control and test reporters being read 10-30 
times each for each day trials were performed. FS rates were determined by taking the 
ratio of firefly to Renila luciferases for each sample, and then taking the ratio of the 
average ratios of the 0 frame samples to that of test reporter ratios to obtain the rates 
for both -1 and +1 PRF. These results were then analyzed by t-test to determine 
statistical significance compared to wild-type levels as previously described [185]. 
Fold changes for mutants were determined based solely on comparison with same day 
testing results of wild type strain, while reported wild type recoding event eficiencies 
represent averages of multiple trials across multiple days. Error bars were calculated 
for wild type and mutant data sets using the following formula: 
Yeast strain standard error for translational recoding event = 
 A(!(((B/C)^2)+((D/E)^2))) 
Yeast Recoding = Test plasmid ratio of (Firefly luciferase) / (Renila luciferase) 
Yeast Control = Control plasmid ratio of (Firefly luciferase) / (Renila luciferase) 
Standard Error = (Standard Deviation of ratio values) / ("n) 
A = Yeast % Recoding; B = Yeast Recoding Standard Error; C = Yeast Recoding 
Average Ratio; D = Yeast Control Standard Error; E = Yeast Control Average Ratio 
 
 
 
62 
In order to incorporate wild type error bars into mutant data sets represented 
as fold wild type the following formula was employed: 
 
Mutant fold standard error with WT error bars factored in =  
V(! (((W/X)^2)+((Y/Z)^2))) 
V = Mutant?s Fold WT Recoding Rate ((% Mutant Recoding) / (% WT Recoding)); 
W = Mutant Standard Error; X = Mutant Recoding %; Y = WT Standard Error; Z = 
WT Recoding % 
 
 Prior to determining rates of UA readthrough (nonsense suppresion), 
strains were cured of the endogenous yeast prion [PSI
+
] by daily serial pasage of 
cels in -trp liquid media containing 5 mM guanidine hydrochloride for 10 days. Rates 
of nonsense suppresion were determined as previously described [180] using the 
LEU2-selectable 0-frame control pJD419 and in-frame UA containing reporter 
pJD702. Misense reporters were based on URA3 plasmids previously described for 
the sense reporter [180] and for the firefly luciferase 218 arginine codon (AGA) to 
serine (AGC) misense reporter plasmid pYDL-AGC [184]. Methodologies were the 
same as those for other dual luciferase asays described above. 
 
Ribosome preparation 
Cels were grown overnight in a 30? C shaker in 500 ml of YPAD media to 
mid-log phase (OD
595
 0.8-1.5), cooled to 4? C for 1 hour to alow ribosomes to run 
off of transcripts while remaining tightly coupled. Cels were harvested by 
centrifugation and washed three times with 40 ml 0.9% KCl solution. Cel pelets 
 
 
63 
were stored at -80? C until needed, at which time they were thawed and resuspended 
in 1 ml binding buffer (10 mM Tris-HCl pH 7.5, 10 mM MgCl
2
, 60 mM NH
4
Cl, 2 
mM DT, 1 mM PMSF) per gram of cels. Cels were lysed with a 1:1 volume of 
Zirconian beads (BioSpec, Bartlesvile, OK) and disrupted using two 2-minute pulses 
of a minibead beater. Lysates were clarified by centrifugation at 20,000 rpm 
(50,000xg) using a swinging bucket MLS-50 rotor at 4? C for 25 minutes. Ribosomes 
were chromatographicaly purified using Sulfolink beads (Pierce, Rockford, IL) 
which consist of a cross-linked agarose resin with 18-atom alkyl chains and an l-
cysteine at the terminal end which binds the rRNA as previously described [186], and 
eluted from the resin in 8 ml of elution buffer (10 mM Tris-HCl pH 7.5, 10 mM 
MgCl
2
, 500 mM KCl, 2 mM DT, 0.5 mg/ml heparin). Eluted ribosomes were treated 
with 2 mM Puromycin (se Figure 22 for structure) and 1 mM GTP for 30 minutes at 
30?C and were layered on top of a 22 ml glycerol cushion (50 mM HEPES-KOH pH 
7.6, 10 mM Mg(CH
3
COO)
2
, 50 mM NH
4
Cl, 1 mM DT, 25% glycerol) and peleted 
by centrifugation at 30,000 rpm at 4?C using a Sorval ultracentrifuge with swinging 
bucket AH-629 rotor for 18-20 hours. Pelets were washed with 1 ml of storage buffer 
(50 mM HEPES-KOH pH 7.6, 10 mM Mg(CH
3
COO)
2
, 50 mM NH
4
Cl, 1 mM DTT, 
25% glycerol), and resuspended in 200-400 ?l of storage buffer. Concentrations were 
determined spectrophotometricaly (1 OD
260
 = 20 pmols ribosomes). The salt-washed 
ribosomes were aliquoted and stored at -80?C for up to 3 months. Ribosomal rRNA 
quality was checked on 1.3% agarose gels and rRNA to protein ratios were monitored 
by determining OD
260
 to OD
280
 ratios. Polysome profiles were obtained by sucrose 
density gradient centrifugation as previously described [187]. 
 
 
64 
 
Figure 22. Structure of puromycin. 
Puromycin binds to the PTC and acts as a miic of the A76 end of an aa-tRNA
Phe
 molecule and can 
act as a an acceptor of peptide bond formation during peptidyl transfer between a peptidyl tRNA and 
itself. 
 
Asays of ribosome/tRNA interactions 
[
14
C]Phe-tRNA
Phe
 and Ac-[
14
C]Phe-tRNA
Phe
 species were synthesized and 
purified by high performance liquid chromatography (HPLC) as previously described 
[188]. Salt-washed ribosomes were thawed and activated at 30?C for 5 min. To 
monitor binding of [
14
C]Phe-tRNA
Phe
 to the A-site, 125 pmoles of ribosomes were 
pre-incubated at 30?C for 30 minutes in 150 ?l of A-Site Binding Buffer (80 mM Tris 
pH 7.4 160 mM NH
4
Cl, 15 mM Mg(CH
3
COO)
2
, 2 mM spermidine, 6 mM "-
mercaptoethanol) containing 1.33 mM GTP, 0.25 mg polyU, 51 ?g soluble binding 
factors generated as described [189], and 0.1 mg uncharged tRNA
Phe
. Subsequently, 
12.5 pmoles of ribosomes were added to 2-fold serial dilutions of [
14
C] tRNA
Phe
 to a 
total volume of 30 ?l and incubated at 30? C for 35 minutes. Samples were pased 
through Milipore (Bilerica, MA) nitrocelulose filters using a multi-sample vacuum 
manifold, filters were washed 3 times with 3 ml of A-site binding buffer, and amounts 
 
 
65 
of bound [
14
C]Phe-tRNA
Phe
 were determined by scintilation counting. Background 
values (no ribosome controls) were subtracted from al samples. Al strains were 
tested at least twice in triplicate. K
D
 values were calculated using GraphPad Prism 
Software fited to 1-site binding with ligand depletion formula: 
Y= (-b+"(b*b-4*a*c))/(2*a) 
X is total ligand added. Y is total binding, X and Y must be expresed in the same 
units. 
Bmax initial Ymax value set to 1.0; a = -1; b = Kd+X+Bmax; c= -1*X*Bmax 
 
 To examine binding of Ac-[
14
C]Phe-tRNA
Phe
 to the P-site, 150 pmoles of 
ribosomes were resuspended in 150 ?l of P-Site Binding Buffer (80 mM Tris pH 7.4 
160 mM NH
4
Cl, 11 mM g(CH
3
COO)
2
, 2 mM spermidine, 6 mM "-me) plus 0.25 
mg polyU. Ribosomes (17 pmoles) were added to 2-fold serial dilutions of Ac-
[
14
C]Phe-tRNA
Phe
 to a total volume of 30 ?l and incubated at 30? C for 40 minutes. 
Filter binding asays and determination of K
D
 values were performed as described 
above. Multiple turnover peptidyl transfer reactions utilized 250 pmoles of ribosomes 
pre-loaded with Ac-Phe-tRNA
Phe
 by incubating for 40 minutes at 30? C with 256 
pmoles of Ac-[
14
C]Phe-tRNA
phe
 in 300 ?l of binding buffer (BB) (80 mM Tris pH 7.4 
160 mM NH
4
Cl, 11 mM Mg(CH
3
COO)
2
, 2 mM spermidine, 6 mM "-
mercaptoethanol) including 0.17 mg of polyuridine. Puromycin was added to each 
100 ?l reaction to a final concentration of 2.5 mM, samples were incubated at 30? C, 
and 10 ?l samples were taken at 2, 5, 10, 20, 40, and 60 minute time points, added to 
90 ?l binding buffer plus 100 ?l of 1M NaOH to stop the puromycin reactions. 
Puromycin acts as an a-tRNA
Phe
 miic, binding to the ribosome?s PTC in the LSU, 
 
 
66 
and acepting peptidyl transfer from the peptidyl tRNA. In this manner, puromycin 
can be utilized to monitor multiple rounds of peptidyl transfer. Two 5 ?l aliquots 
were taken from each sample and added directly to 5 ml of scintilation fluid to 
determine total possible counts. Peptidylpuromycin products were extracted into 400 
?l of ethyl acetate, half of which were added to 5 ml of scintilation fluid for 
counting. Wild type and mutant ribosomes are monitored for activity at each time 
point in paralel to reaction by monitoring survivability of ribosome-tRNA complex 
in the absence of puromycin by scintilation counting after purification through a 
nitrocelulose filter. While these data can not determine ribosomal activity directly 
related to the ribosomes? catalytic functionality, it serves as a rough approximation of 
activity. Data were plotted by counts per minute versus the percentage of N-Ac-
[
14
C]Phe-tRNA
phe
 reacted. The rate of multiple peptidyl turnover events was 
determined by plotting first-order time plots using the formula: ln[100/(100-x)] where 
?x? is the percentage of tRNA reacted with respect to active ribosomal fraction. The 
first 3 time points fel on a straight line, the slopes of which are equal to the rate of 
peptidyl turnover. 
 
rRNA Structural Analysis using SHAPE 
Empty, polyU loaded, or polyU and deacylated P-site tRNA loaded salt-
washed ribosomes (50 pmol) were resuspended in 200 ?l of SHAPE buffer [80 mM 
Tris-HCl pH 7.4, 100 mM NaCl 15 mM Mg(CH
3
COO)
2
] and incubated for 10 
minutes at 30? C. Samples were split, and 10 ?l of dimethylsulfoxide (DMSO) was 
added to half of the samples, while 10 ?l of 60 mM 1-methyl-7-nitroisatoic anhydride 
 
 
67 
(1M7) (se Figure 23 for structure) was added to the other half. Samples were 
incubated at 30? C for 20 minutes. Ribosomes were precipitated by the addition of 
275 ?l of ice-cold 100% ethanol and stored at -20? C for 1-2 hours. Ribosomes were 
peleted by centrifugation at 10000 rpm for 2 minutes and resuspended in lysis buffer 
and rRNAs were isolated using an Ambion (Austin, TX) RNAqueous#-Micro RNA 
isolation kit. Optical densities were taken at 260 nm and 280 nm to monitor the 
quantity and quality of RNA, and samples were resuspended at a concentration of 1 
?g rRNA/7 ?l in pure water. HPLC purified oligonucleotide primers purchased from 
IDT (Coralvile, IA) are listed in Table 2. Oligonucleotides were resuspended to 25 
pmol/?l, 3? end labeled with $[
32
P]ATP with T4 polynucleotide kinase (Roche, 
Indianapolis, IN), and purified from free radiolabeled nucleotide by pasage through a 
MicroSpin G-25 column (GE Healthcare, Piscataway, NJ). Annealing reactions 
utilized 1 ?g of modified rRNAs and 3 ?l of labeled oligonucleotide heated at 80? C 
for 1 minute, followed by a 4-7 minute incubation at 5-10? C below the T
m
 of each 
oligonucleotide. Annealed rRNA/primers (2 ?l each) were added to 3 ?l of cold 
enzyme mix (0.25 ?l 10 mM dNTP, 0.25 ?l 100 mM DT, 1 ?l 5X Superscript III 
Buffer, 0.25 ?l Superscript III (Invitrogen Life Technologies, Carlsbad, CA), 1.25 ?l 
H
2
O). For sequencing samples, an additional 1 ?l of each ddNTP was added to each 
C, T, A, G, sample respectively. Primer extension reactions were performed at 52? C 
for 25 minutes, with potential 2-minute long extensions preceding the 52? C at lower 
temperatures depending on the individual T
m
?s of the primers. Denaturing RNA 
loading dye (2 ?l) was added to each sample, heated to 94? C for 2.5 minutes, and 
 
 
68 
samples were resolved through 8% urea-acrylamide denaturing gels. Gels were dried 
and radiolabeled samples were visualized by phosphorimagery.  
 
 
Figure 23. 1M7 chemical modification of RNA. 
Structure of 1M7 is shown in blue. Depicted is 2? acylation of the RNA backbone by 1M7. 
 
 
 
69 
Primer location on rRNA Primer sequence 
25S, 3? rRNA start at 1107 (H38) 5?-GCTCTTCATCAATGACCACG-3? 
25S, 3? rRNA start at 1248 (H43) 5?-GACTTCCATGCCACCG-3? 
25S, 3? rRNA start at 2340 (H61) 5?-GGACAGTGGATCTC-3? 
25S, 3? rRNA start at 2654 (H82) 5?-GACATCTGCGTATC-3? 
25S, 3? rRNA start at 2768 (H87) 5?-AGCCACACTTCATG-3? 
25S, 3? rRNA start at 2851 (H89) 5?-GTCGCTATGACGCTTGACTG-3? 
25S, 3? rRNA start at 2974 (H93) 5?-ACTCGTCTCACGACGG-3? 
25S, 3? rRNA start at 3017 (H94) 5?-GTCAATACTATGCGG-3? 
25S, 3? rRNA start at 3074 (H96) 5?-CCTGATCAGACAGCCGC-3? 
25S, 3? rRNA start at 3192 (H98) 5?-GACGCCTTATCGTATCC-3? 
18S, 3? rRNA start at 1044 (h25) 5?-ATCCCTAGTCGGCATAG-3? 
18S, 3? rRNA start at 1324 (h37) 5?-CGTATCGCAATAGC-3? 
18S, 3? rRNA start at 1548 (h42) 5?-AGCAATATACAATGC-3? 
18S, 3? rRNA start at 1689 (h44) 5?-CTGAGCCTCACTAGC-3? 
18S, 3? rRNA start at 1784 (h45) 5?-TATGATCCTTCCGCAG-3? 
5S rRNA, 3? rRNA start at 120 5?-AGATGCAGCACC-3? 
Table 2. Oligonucleotides used for primer extension in SHAPE analyses. 
Primers were al ordered from Integrated DNA Technologies and were HPLC purified. 
 
Computational analyses and ribosome structure visualization 
The published structures for the 70S ribosome from E. coli (PDB acesion 
numbers: 2AVY, 2AW4; [15], as wel as yeast 80S structures from yeast (1S1I, 
1S1H, 3JYV, 3JYW, 3JYX; [5,12]) were used in the analysis of this work and the 
generation of figures. Published Thermus thermophilus 70S subunits containing A-
site, P-site, and E-site Phe-tRNA were also employed (1G1X, [65]). Al structures 
were visualized and manipulated using MacPyMol software [190]). 
 
Results 
Generation and initial characterization of rpl11b alleles 
 The visualization of a single salient loop of L11 interacting with peptidyl-
tRNA indicated that it might play a vital role in sensing peptidyl-tRNA occupancy 
status and transmiting this information to other functional centers of the ribosome, 
 
 
70 
likely due to a conformational change of the P-site loop upon interacting with the 
peptidyl tRNA. As cels expresing RPL11B alone were healthier than those solely 
expresing RPL11A, genetic manipulations began with the yeast rpl11A" rpl11B" 
double knockout strain JD1313 expresing wild-type (WT) RPL11B from a low copy, 
URA3-selectable episomal plasmid (pRPL11B-URA3). Oligonucleotide site-directed 
mutagenesis was used to construct a series of mutants, each containing changes of 1, 
4 or 10 sequential amino acids (Figure 17C). Stretches of amino acids from arginine 
51 to arginine 61 in the L11 P-site loop were targeted for site-directed mutagenesis 
expresed from a low copy, TRP1-selectable CEN6 episomal plasmid under control of 
the endogenous RPL11B promoter (pRPL11B-TRP1). This supplies L11B protein to 
the cel at levels equivalent to true wild-type yeast lacking RPL11A. After 
transformation and selection on synthetic deletion (SD) medium lacking tryptophan 
(?trp), cels expresing only mutant rpl11B aleles were identified by their ability to 
grow on SD-trp medium containing 5-fluoroorotic acid (5-FOA). This procedure, 
know as ?plasmid shuffle? selects for yeast lacking the pRPL11B-URA3 plasmid due 
to production of the lethal compound fluorodeoxyuridine, formed as a product of the 
URA3 gene. Three of the multiple substitution mutants were inviable as the sole 
forms of L11B. These were R
51
YTVRTFGIR
60
!alanine (i.e. 51-60A); deletion of 
residues 51-60 (51-60%); and F
57
GIR
60
!alanine (57-60A). Viable mutants, 
R
51
YTV
54
!alanine (51-4A), V
54
RTF
57
!alanine (54-7A), R51A, Y52* (mutations 
including !, A, R, E, S, I, Q, N, H, and F), F57A, and R61A were rescued from yeast 
into E. coli, and the mutations were confirmed by DNA sequencing.  
 
 
 
71 
The L11 P-site loop mutants confer temperature- and drug-specific growth 
phenotypes 
Standard 10-fold dilution spot asays were performed multiple times to 
measure the efects of the L11 P-site loop mutants on cel growth across a range of 
temperatures (30? C, 20? C, and 37? C) (Figure 24A). Growth at 30? C represents the 
ideal state for growth, and thus al other conditions are compared to this baseline. At 
30? C, the 51-4A mutation conferred depresed growth while 54-7A displayed 
roughly wild-type growth. Cold sensitivity was asesed at 20? C and both mutants 
grew at wild-type rates. 51-4A showed enhanced growth at 37? C relative to itself at 
30? C, while mutant 54-7A was similar to wild-type. R51A grew at wild-type rates at 
30? C and 37? C but showed enhanced growth at 20? C. The Y52* mutants displayed 
mutant-specific efects on growth rates at 30? C, but did not confer significant 
phenotypes at either 20? C or 37? C. F57A had wild-type growth rates at al 
temperatures, while R61A showed depresed growth at 30? C, which was rescued at 
37? C.  
 
 
 
72 
 
Figure 24. Phenotypic analyses of the viable L1 mutants. 
(A) 10-fold dilutions of indicated yeast strains were spoted onto SD-Trp media and incubated at 
temperatures indicated, or (B) on SD-Trp media containing paromomycin, anisomycin, or sparsomycin 
at the indicated concentration and grown at 30? C. (C) Kiler virus asays. Wild-type (WT) Killer
+
 
cells are identified by a zone of growth inhibition. 51-4A, 54-7A, and F57A mutants lack this halo, 
indicating the Killer
#
 phenotype. 
 
 
73 
Smal molecule inhibitors of mRNA translation are useful probes for 
identifying changes in ribosome function. This study utilized 3 such molecules: 
paromomycin, anisomycin, and sparsomycin. Al three drugs? efects were monitored 
using dilution spot asays at 30? C on SD?trp media containing various drug 
concentrations. Paromomycin is an aminoglycoside antibiotic that increases 
translational error rates by artificialy stabilizing codon:anticodon interactions at the 
DC in the smal ribosomal subunit [191]. As compared to their intrinsic growth in the 
absence of drug, both the 51-4A and 54-7A mutants were slightly hypersensitive to 2 
mg/ml paromomycin, as were Y52!, Y52N, and Y52H. In contrast, R51A, F57A, and 
R61A were al paromomycin resistant (Figure 24B). Anisomycin competes with the 
3? end of the a-tRNA for binding to the A-site pocket of the ribosome [192,193]. 
Both 51-4A and 54-7A showed anisomycin resistance at 40 ?g/ml, as did several 
Y52* mutants, and R61A (Figure 24B). Sparsomycin binds to the P-site and 
interferes with peptidyl-tRNA binding and peptidyl transfer [193,194]. 51-4A and 54-
7A mutants were hypersensitive to 30 ?g/ml sparsomycin, as were most of the Y52* 
mutants, with the exception of Y52F which conferred slight resistance to sparsomycin 
(Figure 24B). 
The yeast ?kiler? system is composed of the L-A helper and M
1
 satelite 
dsRNA viruses (reviewed in [195]). The L-A dsRNA viral genome encodes a capsid 
protein (Gag), and an RNA-dependent RNA polymerase (Pol) that is synthesized as a 
Gag-pol fusion protein consequent to a -1 PRF event [196]. The M
1
 satelite dsRNA 
is encapsidated and replicated in L-A encoded viral particles, and the M
1
 (+) strand 
encodes a secreted toxin that kils uninfected yeast through its interactions with the 
 
 
74 
GPI-anchored Kre1p cel wal asembly protein [197]. Changes in -1 PRF eficiency 
alter the ratio of Gag to Gag-pol, and inhibit the ability of cels to maintain M
1
 [179]. 
To monitor the efects of the mutants on Kiler virus maintenance, colonies of 
JD1313 cels expresing either wild-type or mutant rpl11B aleles were spotted onto a 
lawn of diploid, Kiler
-
 indicator cels. Cels expresing wild-type RPL11B were 
Killer
+
 as demonstrated by their ability to inhibit growth of the indicator cels (Figure 
24C). In contrast, isogenic cels expresing either the 51-4A, 54-7A, and F57A 
mutants were Kiler
-
. A weak kiler phenotype, defined by decreased zones of growth 
inhibition, was observed in mutants Y52E, Y52N, Y52H, and F57A. 
 
The rpL11B mutants affect translational fidelity 
?Translational fidelity? is used to describe the acuracy of protein synthesis. A 
series of bicistronic reporter plasmids were used to quantitatively monitor the efects 
of the L11B mutants on four aspects of translational fidelity: -1 PRF, +1 PRF, 
suppresion of a UA nonsense codon, and incorporation of a misense near-cognate 
amino acid. In JD1313 cels expresing wild-type RPL11B, -1 PRF directed by the L-
A dsRNA viral signal was 6.07% ? 0.16%. This compares favorably with other 
?wild-type? strains in our laboratory (normal range from 4?8%, se [180,185]). The 
51-4A mutant promoted increased -1 PRF (1.33 ? 0.06 fold relative to wild-type), 
while 54-7A trended in the opposite direction (0.84 ? 0.03 fold relative to wild-type) 
(Figure 25, and Table 3). Both these values were statisticaly significant and 
correlates wel with the Kiler
-
 phenotypes. Y52!, Y52N, Y52E, and Y52H mutants 
also showed increased rates of -1 PRF, with statisticaly significant rates ranging from 
 
 
75 
Y52H at 1.20 fold wild-type to Y52E at 1.49 fold wild-type. Y52A, Y52S, Y52Q, and 
Y52F al had wild-type rates of -1 PRF. 
 
Figure 25. The L1B mutants promote defects in translational fidelity. 
Isogenic yeast cels expresing either wild-type or mutant forms of L1B were transformed with dual 
luciferase reporters and control plasmids and rates of translational recoding were determined. All 
results are graphed as fold wild-type. -1 PRF was measured using the yeast L-A virus frameshift 
signal. +1 PRF was directed by the frameshift signal derived from the Ty1 retrotransposable element. 
Nonsense supresion denotes the percentage of ribosomes able to supres an in-frame UA 
termination codon positioned betwen the Renila and firefly luciferase reporter gens. Misense 
supression rates were evaluated by incorporation of an arginine (AGA) near-cognate amino acid 
instead of a cognate serine (AGC) at the catalytic codon 218 within the firefly luciferase gene. Eror 
bars denote standard eror. Asterisks above samples indicate staisticaly signifcant changes as 
determined by t-test.  
 
While both -1 and +1 PRF are kineticaly driven events, the substrates for the 
slippage are distinct: -1 PRF requires that both the ribosomal A- and P-sites are 
occupied by tRNAs, while +1 PRF occurs while the A-site is empty (reviewed in 
[132]. Rates of +1 PRF were monitored using a cis-acting signal derived from the 
 
 
76 
Ty1 retrotransposable element using pYDL-Ty1. Baseline +1 PRF eficiencies in 
cels expresing wild-type RPL11B were 10.98% + 0.30%. 51-4A had no efects on 
+1 PRF, while 54-7A promoted a smal but statisticaly significant increase (1.18 ? 
0.06 fold of wild-type, se Figure 25). Significant changes in +1 PRF were also 
observed in Y52A, Y52S, Y52N, Y52E, Y52H, and Y52F. mRNA decoding occurs in 
the SSU DC, and changes in termination codon recognition (nonsense suppresion) is 
another indicator of altered translational fidelity. pYDL-UAA [198], which contains 
an in-frame termination codon immediately 5? of the firefly luciferase gene, was used 
to monitor this parameter. The baseline rate of nonsense suppresion in cels 
expresing RPL11B was 0.137% + 0.003%. The 51-4A mutant slightly improved this 
aspect of translational fidelity, with nonsense suppresion levels decreasing to 0.88 ? 
0.04 fold of wild-type levels. 54-7A did not afect UA recognition (Fig 3). Y52!, 
Y52A, Y52S, Y52N, Y52E, and Y52H al promoted increased rates of nonsense 
suppresion ranging from 1.31 to 1.78 fold wild-type. pYDL-AGC
218
 tests misense 
suppresion levels by monitoring rates of incorporation of an arginine (AGA) near-
cognate amino acid instead of a cognate serine (AGC) at the catalytic codon 218 
within the firefly luciferase gene as previously described [184]. Thus, in this asay, 
misincorporation of near-cognate tRNA
Arg
 at the Ser AGC codon restores firefly 
luciferase activity. Wild-type misense levels were measured at 0.074% + 0.002, 
comparable to previous studies [184]. Mutant 51-4A had significantly higher levels of 
misense suppresion (measured at 1.21 + 0.03 fold wild-type), while 54-7A did not 
significantly afect this phenomenon (1.07 + 0.04 fold wild-type) (Figure 25). 
Misense suppresion was not asayed for the single amino acid mutants. 
 
 
77 
 
 51-4A 54-7A 
H84 SHAPE Protected Deprotected 
P-tRNA binding $ K
D
 % K
D
 
Peptidyl Turnover Rate Increased Decreased 
Sparsomycin (P-site) Hypersensitive Hypersensitive 
aa-tRNA binding % K
D
 $ K
D
 
Anisomycin (A-site) Resistant Resistant 
Missense Increased No efect 
Paromomycin (DC) Hypersensitive Slightly Hypersensitive 
-1 PRF Increased Decreased 
Killer Killer
-
 Killer
-
 
+1 PRF No efect Increased 
Table 3. Summary of experimental findings for the 51-4A and 54-7A mutants of yeast L11. 
 
The mutant rpl11b alleles promote opposing effects on tRNA binding to the 
ribosomal A- and P-sites 
Sucrose gradient analyses were employed to fractionate cycloheximide 
arrested elongating ribosomes on mRNAs in lysates generated from JD1313 cels 
expresing wild-type L11B, 51-4A, and 54-7A. In al strains the 60S peak was 
smaler than that of the 40S fraction which can be atributed to the presence of only a 
single copy of RPL11B, which has previously been shown to efectively reduce the 
number of 60S subunits produced by the cel to 60-66% of true wild-type levels while 
having no visible phenotypic efect on growth [174]. No significant diferences were 
observed among the samples (data not shown). Phenotypic variation in PRF, as well 
as in the presence of anisomycin and sparsomycin, are indicative of altered 
 
 
78 
interactions betwen the ribosome and tRNAs. P-site tRNA K
D
s were determined in 
vitro by binding 2-fold serial dilutions of N-acetylated-[
14
C]Phe-tRNA to ribosomes 
until saturation was achieved (Figure 26A), and the resulting data were used to 
determine steady state single site binding K
D
 values (Figure 26B). Wild-type 
ribosomes bound this P-site substrate with a K
D
 of 72.3 ? 7.9 nM. The 51-4A mutants 
promoted a slight increase in afinity for P-site substrate (K
D
 = 50.9 ? 11.2 nM), 
while 54-7A had the opposite efect (K
D
 = 89.3 ? 10.4 nM). Given the physical 
interaction betwen the L11 P-site loop and peptidyl-tRNA, it was imperative to 
determine whether the observed smal changes in P-site afinities promoted by the 
mutants were biochemicaly significant. To this end, multiple turnover puromycin 
reactions were performed. In these experiments, puromycin was added to ribosomes 
pre-incubated with exces P-site substrate, i.e. Ac-[
14
C]Phe-tRNA
Phe
, and 
acumulation of the peptidylpuromycin product was monitored over time. In these 
reactions, the first round of peptidylpuromycin synthesis is very rapid. Next, in a slow 
step, the ribosome intrinsicaly translocates the deacylated tRNA
Phe
 into the E-site 
[199], followed by the slow difusion of Ac-[
14
C]Phe-tRNA
Phe
 into the P-site where it 
can react with puromycin. Repetition of this cycle results in slow multiple rounds of 
product synthesis (Figure 26C). Asuming that the L11 mutants do not afect either 
rates of intrinsic translocation or of Ac-[
14
C]Phe-tRNA
Phe
 difusion into the P-site, 
changes in product acumulation should be due to diferences in binding afinities for 
the P-site substrate. Consistent with this model 51-4A promoted 1.46 ? 14 fold 
increased K
obs
 relative to wild-type ribosomes, while 54-7A decreased K
obs
 to 0.51 ? 
0.01 fold that of wild-type (Figure 26D). To asay for changes in tRNA binding to the 
 
 
79 
A-site, K
D 
values were determined in vitro by binding 2-fold serial dilutions of 
[
14
C]Phe-tRNA
Phe
 to ribosomes pre-loaded with uncharged tRNA
Phe
 in the P-site. 
Wild-type K
D
 values were 103 ? 11 nM. 51-4A promoted decreased afinity for the 
substrate with a value of 150 ? 19 nM, while 54-7A promoted a smal increase in 
afinity (84 ? 7 nM) (Figure 26E and F).  
 
Figure 26. The L1B mutants promote opposite K
D
s for tRNA species. 
(A) Binding of tRNA to the P-site. Logarithmic and linear X-axis shown. 17 pmoles of salt washed 
ribosomes (567 nM ribosomes) wer incubated for 40 minutes at 30? C with 2-fold dilutions of N-
acetylated-[
14
C]Phe-tRNA and poly(U). 80S-tRNA-poly(U) complexes were bound to nitrocellulose 
filters and washed with binding buffer. Samples were read by radioactive scintilation counting. Curves 
were generated using GraphPad Prism 4. (B) P-site tRNA binding K
D
s were determined using one site 
binding with ligand depletions equation. Eror bars show standard error of variables calculated from 
 
 
80 
thre binding reactions per mutant strain. (C) Peptidylpuromycin product formation over time and 
first-order time plots of multiple turnover peptidylpuromycin reaction. Ribosomes pre-bound with N-
acetylated-[
14
C]Phe-tRNA and poly(U) were incubated with puromycin. ?x? equals % of tRNA 
reacted. (D) Fold wild-type rates of peptidylpuromycin product formation as monitored by change in 
slope of first order time plots. Eror bars show standard deviations. (E) Binding of tRNA to the A-site. 
Logarithmic and linear X-axis shown. Salt washed ribosmes wer pre-incubated at 30? C with 
tRNA
Phe
 to block the P-site, then incubated for 35 minutes with [
14
C]Phe-tRNA plus binding factors 
and poly(U) as described for P-site binding. (F) K
D
s for A-site tRNA binding. Eror bars show 
standard error of variables calculated from three binding reactions per strain. 
 
The P-site loop is flexible depending on the ocupancy status of the P-site 
The highly basic nature of the P-site loop, its interaction with peptidyl-tRNA, 
and its proximity to 25S rRNA Helix 84 (H84) suggested that it might interact with 
either of these two RNA components depending on the occupancy status of the P-site. 
Changes in interactions betwen the P-site loop and local rRNA structures may in 
turn propagate outward to more distant regions of the ribosome. To test this, selective 
2'-hydroxyl acylation analyzed by primer extension (SHAPE) [200,201,202] was 
employed to probe for structural alterations in selected regions of the 25S, 18S, and 
5S rRNAs due to either the L11B mutants or in wild-type ribosomes with occupied or 
unoccupied P-sites. Due to the large size and complex 3-dimensional structure of the 
ribosome, the entire rRNA content was not examined. Rather, approximately one 
third of the rRNA bases were interrogated, focusing on those bases closest to L11, the 
A- and P-sites, and the DC (Figure 27).  
 
 
 
81 
 
Figure 27. 3-dimensional representation of rRNAs probed by SHAPE. 
Locations of 25S, 18S and 5S rRNA bases within the 80S ribosome probed with 1M7 and their relative 
proximities to L11. Probed bases are shown in bright purple and viewed from 2 angles. 
 
In the first series of experiments, salt washed wild-type and 51-4A, 54-7A, 
Y52Q, and Y52F mutant ribosomes (chosen for structural analyses because they had 
the most pronounced genetic phenotypes) were treated with 1M7, an electrophile that 
adds an adduct onto the 2?OH groups of solvent exposed base sugars. Modifications 
were performed on salt washed ribosomes because they represent the thermodynamic 
?ground state? of the ribosome. Thus, the structural changes observed are indicative 
 
 
82 
of changes in the full ?dynamic potential? of the ribosome as opposed to 
conformations locked in by e.g. occupation of binding sites by tRNAs or ribosome-
asociated factors. rRNAs were extracted, hybridized with 5? [
32
P]-labeled 
oligonucleotide primers, and reverse transcriptase primer extension reactions were 
performed. The products were separated through urea-acrylamide denaturing gels, 
and visualized using a phosphorimager. 2?-OH ribose modification results in a strong 
stop one nucleotide 3? of modified bases, and the intensity of the stops are 
proportional to the solvent acesibility and flexibility of riboses. Comparison of the 
protection paterns betwen wild-type and mutant ribosomes enables identification of 
specific bases which became protected or deprotected relative to WT. 
In al areas examined, rpl11b ribosomes Y52Q and Y52F matched the wild-
type rRNA base modification profile (data not shown), while 51-4A and 54-7A 
ribosomes revealed consistently reproducible diferences. The most significant 
changes in rRNA structure were observed in bases C2675-A2679 (E. coli numbering: 
C2306-2310) located in the terminal loop of 25S rRNA H84 (Figure 28A/E). The two 
mutants promoted opposing paterns of base protection/deprotection in this structure. 
Specificaly, as compared to wild-type ribosomes, 51-4A promoted enhanced 
protection of this loop, while the loop was deprotected in the 54-7A mutants. 
Analysis of the recent cryo-EM yeast ribosome structure [12] revealed that these H84 
loop bases are located within 3? of the stretches of amino acids changed to alanines 
in both the 51-4A and 54-7A mutants (Figure 28B). These findings suggested that the 
two mutants had the efects of locking the P-site loop into two opposing 
conformational states: extended toward the P-site (54-57A), or retracted into H84 (51-
 
 
83 
54A). To test whether these two states are naturaly dependent on P-site occupancy, 
the experiments were repeated with wild-type and mutant ribosomes with or without 
tRNA
Phe
 in their P-sites. Consistent with this model, addition of tRNA to the P-site of 
wild-type ribosomes resulted in slightly enhanced protection of the H84 terminal loop 
bases closest to the P-site loop (A2676-A2679). Interestingly, C2675 showed 
significant deprotection when the P-site was occupied by tRNA. This base is on the 
far side of the terminal end of H84 from the P-site loop, suggesting that H84 itself 
alters its conformation upon tRNA occupancy of the P-site (Figure 28C). 51-4A?s 
H84 bases were unchanged betwen P-site bound and unbound ribosomes, consistent 
with the P-site loop positioned in the ?retracted? state in this mutant, although smal 
diferences in the protection paterns suggest that the P-site loop is in a slightly 
diferent orientation in this mutant. In contrast, while 54-7A ribosomes, i.e. the P-site 
loop ?extended? state, showed deprotection at al bases (C2675-A2679) for both P-
site bound and salt washed ribosomes, bases A2676-A2679 were les deprotected 
when tRNA was in the P-site and C2675 was even more reactive, consistent with the 
notion that the P-site loop interacts with H84 when peptidyl-tRNA is in the P-site.  
 
 
 
84 
 
Figure 28. L1 mutants promote local and distant changes in rRNA structure. 
(A) 1M7 SHAPE modification of wild-type and mutant salt washed ribosomes show oposite efects 
of solvent acesibility on H84 bases C2675-A2679 in mutants 51-4A and 54-7A relative to wild-type. 
DMSO lanes are unmodified controls. Sequencing lader is shown to the left. (B) PyMol generated 
image of H84?s protected/deprotected bases (black with gray surface) in mutants 51-4A and 54-7A 
respectively, for salt-washed empty ribosomes. P-site tRNA is aded for reference. Blue spheres mark 
amino acids changed to alanines in 51-4A, red for 54-7A, purple is mutated in both. (C) Changes in 
H84 acesibility upon binding of P-site tRNA. Ac-Phe-tRNA
Phe
 was pre-bound to salt washed 
ribosomes along with poly(U) and complexes were probed with 1M7 or DMSO controls. In both wild-
type and 54-7A base C2675 became more deprotected with tRNA bound to the P-site while bases 
A2676-A2679 show increased protection. 51-4A?s level of protection is unchanged. (D) Diferences 
observed, in both treated and untreated lanes, of natural stops betwen wild-type and mutant strains in 
the terminal lop of 25S rRNA Helix 88 (A279, A2780), and in Expansion Segment 31 (C2531, 
G2534). (E) 2-dimensional structure of yeast 25S rRNA showing locations of bases showing changes 
in reactivity. H84 gray highlighted bases protected/deprotected relative to wild-type in empty salt 
washed ribosomes in the 51-4A and 54-7A mutants respectively. Open circled bases indicate sites of 
decreased innate lability (C2531, G2534) in ES31 for both 51-4A and 54-7A, or increased natural 
lability (A279-A2780) in H88 for the 51-4A mutant. 
 
 
85 
 
 
Although no other SHAPE-specific changes were observed, several other 
phosphodiester bonds 3? of specific 25S rRNA bases were reproducibly more, or les, 
intrinsicaly labile as compared to wild-type (Figure 28D). In both mutants, G2531 
and G2534 located in expansion segment (ES)31 were more stable than in wild-type 
ribosomes as evidenced by reduced intensity of strong reverse transcriptase stops 1 
nucleotide 5? of these bases. Additionaly, bases A2779-A2780 (E. coli A2407-
U2408) located in the terminal loop of Helix 88 were hyper-labile in 51-4A mutant 
ribosomes as compared to WT, as shown by the presence of strong stops with 
increased intensity 1 nucleotide 5? of these bases. These are mapped onto the two-
dimensional structure of yeast 25S rRNA (Figure 28E). 
 
Discusion 
The L11 P-site loop is largely comprised of polar amino acids and carries a 
net positive charge, making it ideal for interactions with the phosphate backbones of 
nucleic acids, e.g. rRNA and tRNA. Positioned betwen H84 and the peptidyl-tRNA 
T-loop, several of its amino acids are within H-bonding distance of H84 (~3.3?), 
while C56 of the peptidyl tRNA T-loop comes within 2.1? of G58 in the L11 P-site 
loop [12,65], suggesting that the L11 P-site loop can directly interact with both of the 
RNA-based structures. While currently available X-ray crystal structures are 
unavailable for ratchet-state ribosomes, a recently published examination of tRNA 
movement through the E. coli ribosome using large scale analysis of cryo-EM images 
implicates L11?s P-site loop as a dynamic arm interacting with and moving in relation 
 
 
86 
to tRNAs pasing across the P-site [13]. These studies were performed at resolutions 
of 9-20?, leaving a level of ambiguity as to the exact residues involved, yet clearly 
showing interactions betwen L11 and both P-site and E-site tRNAs. Although death 
is not a phenotype per se, the inviable mutants are informative nonetheles in so far as 
they demonstrate that the amino acids F
57
GIR
60
 are absolutely required for viability. 
While F57 is universaly conserved, it does not appear to be esential on its own for 
viability, as witnesed in the mild phenotypes of the F57A mutant. Similarly, al 
single amino acid changes explored here resulted in viable mutations, suggesting 
biochemical/biophysical redundancy within this esential loop. In support of this 
notion, the strongest growth phenotypes observed across a range of temperatures and 
smal molecule translational inhibitors were concentrated in the multiple alanine 
substitutions, i.e. 51-4A and 54-7A, thus directing the bulk of the biochemical and 
structural analyses to these two mutants. 
Analysis of the results of the asays performed in the current study 
(summarized in Table 1) provoke the hypothesis that the L11 P-site loop may 
dynamicaly function to help the ribosome sense the occupancy status of the large 
ribosomal subunit P-site. This is modeled in Figure 29. When the P-site is 
unoccupied, the P-site loop can extend into this space, moving away from the 
terminal loop of H84. Upon occupation of the P-site, the peptidyl-tRNA T-loop 
displaces the L11 P-site loop, causing its retraction into H84. By this model, the 
rRNA SHAPE analyses depicting increased protection of Helix 84 by the 51-4A 
mutant shows that this mutant drives the L11 P-site loop equilibrium toward the 
?retracted? state. Conversely, increased deprotection of Helix 84 in the 54-7A mutant 
 
 
87 
suggests that this more miics the P-site unoccupied state, i.e. the ?extended? P-site 
loop state. This analysis directly explains the P-site binding data. Retraction of the P-
site loop from the P-site results in 51-4A ribosomes having higher intrinsic afinity 
for this substrate while extension of this structure into the P-site creates a steric clash 
with the peptidyl-tRNA T-loop, resulting in decreased afinity for this substrate. That 
neither mutant conferred optimal peptidyl-tRNA P-site occupancy may acount for 
their hypersensitivity to sparsomycin, especialy for 54-7A who?s P-site loop is 
already competing with the tRNA for the P-site. Mutants 57-60A, 51-60A, and 51-
60! appear to disrupt the normal function of the P-site loop to a lethal level. In 
addition, the observation that tRNA binding to the P-site results in deprotection of 
C2675 implicates H84 itself as a structuraly dynamic unit. The functional 
consequences of this are not clear, although it is tempting to speculate that this 
conformational change may play a role in the structural rearrangements of the B1b 
and B1c bridges betwen the pre- and post-translocational states. 
 
 
 
88 
 
 
Figure 29. Model: the P-site lop acts as a sensor of the ocupancy status of the P-site. 
Top left panel: when the LSU P-site is unocupied by tRNA, the L1 P-site lop is able to extend into 
this space leaving the distal loop of H84 partially deprotected from chemical atack. This conformation 
is favored by the 54-7A mutant of L11B. Top right panel: ocupation of the P-site by peptidyl-tRNA 
displaces the L11 P-site lop, causing it to tightly retract from the P-site and interact with H84, 
resulting in increased protection of the H84 terminal lop from chemical atack. H84 likely moves 
towards the P-site lop slightly, increasing the exposure of C2675 to the surounding solvent. This 
conformation is favored by the L11B 51-4A mutant. Botom panel: Pymol model image. L1, cyan; 
H84, yelow; 5s rRNA, red; S18, dep purple carton; peptidyl-tRNA, tan; P-site lop, moving purple 
loop. 
 
 
 
89 
The lack of rRNA structural changes in the A-site or in the DC suggest that 
the biochemical and phenotypic efects observed are indirectly due to the changes 
described above. The reciprocal efects betwen Ac-aa-tRNA binding with the P-site 
and a-tRNA interactions with the A-site are intriguing. In the a-tRNA binding 
reactions, the ribosomal P-sites were occupied with deacylated tRNA. We suggest 
that in the 51-4A mutant, the P-site ligand is more ?locked? into a suboptimal 
conformation, which in turn feds back to the A-site, resulting in decreased afinity 
for its ligand. Conversely, the lesened ability of 54-7A mutant ribosomes to lock P-
site ligand in a suboptimal conformation may acount for the increased afinity of 
these ribosomes for A-site ligand. Anisomycin resistance by both mutants also 
followed the reciprocal P-site/A-site patern, i.e. both mutants were sparsomycin 
hypersensitive. Paromomycin interacts with the DC in the SSU, where it promotes 
misreading of near-cognate codons in the A-site by stabilizing codon-anticodon 
interactions [203]. This sensitivity may be atributable to an observed increase in 
misense incorporation of a near cognate arginine (AGA) over that of the sense serine 
codon (AGC) in mutant 51-4A. Intriguingly, 54-7A had wild-type levels of misense 
incorporation suggesting that its sensitivity to paromomycin was indirect. The 
reciprocal anisomycin/paromomycin phenotypes of the L11 mutants demonstrate the 
efects of this protein on A-site ligand based ribosomal functions over very long 
distances. Similar phenotypic paterns were previously observed with mutants of 
other LSU components [204,205].  
The observed efects on -1 PRF are consistent with a recent kinetic analysis 
demonstrating that a-tRNA slippage is the most highly weighted parameter in 
 
 
90 
determining the rate at which this proces ocurs [206]. Here, increased afinity for 
aa-tRNA by the LSU suggests that the 51-4A ribosomes stabilize the frameshifted 
(i.e. near-cognate) tRNAs, reducing their ability to be proofread, thus promoting 
increased rates of -1 PRF. This is consistent with the observed increased rates of 
misense decoding in this mutant. Conversely, post-slippage A-site tRNAs are even 
les stable in the 54-7A mutants, leading these to be more eficiently proofread, and 
thus promoting decreased -1 PRF eficiency. In both cases, altering -1 PRF from the 
optimum ?golden mean? precludes these cels from maintaining the yeast kiler virus 
[179,207]. +1 PRF is completely dependent on peptidyl-tRNA slippage. Increased +1 
PRF in the 54-57A mutant is consistent with decreased afinity for this substrate. The 
failure to observe decreased +1 PRF in the 51-54A mutant, despite its increased 
afinity for peptidyl-tRNA, is not entirely clear, although this may be due to the 
inability of these ribosomes to achieve a threshold beyond which +1 PRF efects can 
be observed. 
The changes in rRNA stability observed in the terminal loop of Helix 88 and 
in ES31 are intriguing. Chemical protection experiments revealed the terminal loop of 
Helix 88 is involved in a kising loop interaction with the terminal loop of Helix 22, 
and this interaction is apparent in the X-ray crystal and cryo-EM structures [12,208]. 
Increased lability at A2779 and A2780 was previously observed in the Y11C mutant 
of ribosomal protein L10 (homolog of E. coli L16) located at the base of the a-tRNA 
accommodation corridor, and in the &2922C (E. coli U2554) 25S rRNA mutant 
located in the PTC [209,210]. The observation that mutations located in three very 
diferent and topologicaly distinct regions of the LSU conferred similar structural 
 
 
91 
efects suggest that this kising loop interaction plays an important role in ribosome 
function. Its location on the cytoplasmic face of the ribosome where deacylated tRNA 
leaves the molecule implies that the interaction betwen the terminal loops of Helices 
88 and 22 may be involved in gating this deacylated tRNA exit corridor open and 
closed. This is consistent with the model of alosteric coordination betwen the A- 
and E-sites [211,212], which would indicate that the defects conferred by al of these 
mutants on a-tRNA binding might impair this E-site gating function. The decreased 
lability of C2531 and G2534 in ES31 is similarly intriguing, raising more questions 
than answers. No function is currently asociated with this ES, but recent cryo-EM 
analysis shows it to be located on a solvent acesible surface of the LSU [12]. 
Perhaps this site is also involved in A-site/E-site coordination. Alternatively, it may 
be a site for recognition of defective ribosomes by the non-functional ribosome decay 
apparatus. 
 
 
 
 
92 
 
Chapter 3 
Identification of a Network of Information Flow through the 
Ribosomal B1b/c Intersubunit Bridge 
Introduction 
The ribosome must coordinate a series of rapid, highly acurate events 
betwen multiple locations and molecules through every stage of protein synthesis. 
During the elongation cycle alone, these include discriminating among cognate and 
non- or near-cognate a-tRNA complexed with an elongation factor (EF-Tu in 
Bacteria and Archaea, eEF1A in eukaryotes), reading mRNA codons in the SU DC, 
acommodating a-tRNAs into the PTC of the LSU, catalyzing peptide bond 
formation, and recruiting and stimulating GTP hydrolysis by the translocase (EF-G in 
Bacteria and Archaea, and eEF2 in eukaryotes). The cycle is completed by 
translocation of the ribosome along the mRNA by three nucleotides in the 3? 
direction. While our understanding of the biochemistry and local structural changes 
that occur during each step of elongation are becoming clear, deciphering how 
numerous widely separated regions of this macromolecule coordinate their actions 
with one another is les apparent. Mapping of the alosteric communication pathways 
betwen diferent functional centers to beter understand how the ribosome 
synchronizes the various steps of translation, particularly betwen the large and smal 
subunits, is thus a critical chalenge to understanding the relationship betwen 
ribosome structure and function.  
 
 
93 
In the past decade, high resolution X-ray crystalographic and near-atomic 
resolution cryo-EM datasets have revealed numerous intra- and inter-subunit 
interactions [9,12,13,15,64,65]. In particular, the LSU and SU directly interact 
through a series of 17 intersubunit bridges [9,14]. Most of these involve either RNA-
RNA or RNA-protein interactions. The exception is the B1b/c bridge, which is 
formed betwen the LSU ribosomal protein L11 in yeast (L5 in Bacteria and 
Archaea) and the SSU protein S18 (S13 in Bacteria and Archaea) [9]. In yeast, the 
esential protein L11 is located on the intersubunit face of the central LSU 
protuberance where it interacts with H84 of the 25S rRNA and with 5S rRNA (Figure 
30A). L11 can be roughly divided into three regions: the P-site loop which 
dynamicaly interacts with H84 and the P-site tRNA [213], a central region that 
interacts with 5S rRNA, and the intersubunit face which participates in the B1b/c 
intersubunit bridge. Cryo-EM studies of ribosomes sampled through the elongation 
cycle have revealed a ratcheting motion betwen the large and smal subunits during 
the proces of translocation. This movement breaks the B1b L11-S18 bridge and 
rearranges it to the B1c conformation [7,17,169]. Previous studies suggested that a 
series of diferential charges betwen the LSU and SU protein partners involved in 
these bridges provide ?sticky and slippery? surfaces that aid in both the movement 
and placement of the ratcheting subunits [8,214].  
 
 
 
94 
 
Figure 30. Location of L1 in the ribosome. 
(A) Image of the yeast ribosome. The LSU is colored gren, and the SSU is pink. L1 (cyan) is located 
in the CP of the LSU wher it interacts with 5S rRNA, Helix 84 of 25S rRNA, the T-loop of the 
peptidyl-tRNA, and the SSU protein S18 via the B1b and B1c intersubunit bridges. (B) Close-up view 
of L11 and neighboring structures. Amino acids of L11?s intersubunit region targeted for mutation are 
colored orange, red, and pink, coresponding to the colored amino acid shown. Ribosomal structures 
generated in PyMol using yeast cryo-EM [12] fited with tRNAs from T. thermophilus [65]. tRNAs 
were docked to ribosome using rpS18 as an ?anchor? in a tRNAs+S18 object using S18 alignment 
feature of PyMol. T. thermophilus S18 was then hiden for purposes of image generation. 
 
Studies have linked mutations in human L11 to Diamond-Blackfan anemia 
[178,215,216], and L11 has also been shown to play a role in ribosome biogenesis 
control and regulation of the MDM2-p53 pathway [217,218,219]. Further 
understanding of L11?s role in the ribosome may shed light on the molecular 
mechanisms underpinning these findings. While it is possible that the B1b/c bridge 
may only function as a mechanical ?doorstop? on the motions of the ratcheting 
ribosome, L11?s close proximity to the P-site implies it may have an important role in 
communicating information betwen diferent functional centers in the two subunits. 
The current study focused on identifying the critical amino acid residues of L11 
 
 
95 
located in the B1b/c bridge region with respect to their roles in ribosome function at 
biological, biochemical, and structural levels. The results agree wel with the view 
that the bridge plays a crucial role as a ?molecular ruler? to aid in establishing 
preferred ratchet orientations. Further, structural analyses of mutants that most 
strongly disrupted the alternating positive/negative amino acid charge motifs revealed 
alosteric lines of information transmision through L11 from the DC on the SU to 
the PTC on the LSU. A model describing L11?s role in a ribosome ?wiring diagram? 
is presented. 
 
Materials and Methods 
Most materials and methods were previously described in Chapter 2, or the 
recent publication [213]. Oligonucleotide primers used for generation of L11 bridge 
mutants are listed in Appendix C, Table 7. Oligonucleotide primers used for structural 
analysis by SHAPE [202] are listed in Table 2 (Chapter 2). The published structures 
for the 70S ribosome from E. coli (PDB acesion numbers: 2AVY, 2AW4; [15]), as 
wel as 80S structures from yeast (3JYV, 3JYW, 3JYX; [5,12]) were used in the 
analysis of this work and the generation of Figures. Published Thermus thermophilus 
70S subunits containing A-site, P-site, and E-site Phe-tRNA were also employed 
(1G1X [65]). Al structures were visualized and manipulated using MacPyMol 
software [190]. 
 
 
 
96 
Results 
Generation of rpl11 alleles and genetic analyses 
L11?s esential nature, its close proximity to the tRNA binding sites, and its 
unique status as a member of the only protein-protein intersubunit bridge spurred an 
examination of its role in the physical transmision of information asociated with the 
B1b/c intersubunit bridge. Scanning site-directed mutagenesis was performed to 
identify the amino acids of greatest importance to L11?s contribution to the B1b/c 
bridge, involving the mutation of 3 or 4 sequential amino acids at a time in regions 
K
87
EYQ
90
, E
108
HID
111
, and I
114
KYD
117
 (Figure 30B). Each region was either deleted, 
changed to alanine, or given a positive charge by mutagenesis to poly-arginine, as 
previous surveys of the structure have suggested the B1b/c bridge movement and 
position may be partialy controlled by diferentialy charged bands betwen L11 and 
S18 [8,214]. Of the 15 ?regional mutants? created, only H
109
ID
111
 to poly-arginine 
(109-111R, this nomenclature is used throughout), was inviable. At 30? C, al the 
other regional mutants grew at wild-type levels except for 114-116R, which exhibited 
a slow growth phenotype (Figure 31A).  
 
 
97 
 
Figure 31. Phenotypic analyses of the viable L11 mutants. 
(A) 10-fold dilutions of indicated yeast strains were spoted onto SD-Trp media and incubated at 
temperatures indicated, or (B) on SD-Trp media containing paromomycin, anisomycin, or sparsomycin 
at the indicated concentration and grown at 30? C. (C) Kiler virus asays. Wild-type (WT) Killer
+
 
cells are identified by a zone of growth inhibition. Inability to maintain the Kiler
+
 phenotype indicates 
altered translational fidelity. 
 
To determine which amino acid of the lethal mutant was most important for 
cel survival, single amino acid alanine and arginine mutations were generated at 
H109, I110, and D111. Additionaly, an H109E mutant was generated to observe the 
efects of a charge reversal. While I110A and D111A displayed wild-type 
phenotypes, H109A promoted depresed growth rates at 30? C, and H109E was even 
further impaired (Figure 31A). For this reason, H109 was selected for further 
mutagenesis to a wide range of amino acids, as shown in Figure 31A. Al H109 
mutants were viable. Subsequently, the efects of these mutants on growth rates were 
monitored by standard 10-fold dilution spot analysis on SD-trp and grown at 30? C, 
20? C, and 37? C. As 30? C represents the optimum temperature for yeast growth, al 
 
 
98 
other temperature and drug effects were compared to this baseline. At 30? C, slow 
growth phenotypes were observed in the H109A, H109E, H109N, H109F, D111R, 
and 114-116R mutants. While several of the regional mutants were sensitive at 20? C, 
al H109 mutants were unafected, growing at rates consistent with those observed at 
30? C relative to wild-type. At 37? C H109R?s growth was decreased, while the slow 
growth phenotypes observed at 30? C were corrected in the H109A, H109E, H109N, 
H109F, and D111R at the higher temperature. Only the 87-90! mutant promoted 
decreased growth at 37? C (Figure 31A).  
 Smal molecule translational inhibitors can provide insight into changes in 
specific functional centers of the ribosome. This study employed 3 such compounds: 
paromomycin, anisomycin, and sparsomycin. Efects on growth were monitored by 
dilution spot analysis on SD-trp at the drug concentration indicated in Figure 31B, 
and cels were grown at 30? C. The aminoglycoside antibiotic paromomycin, which 
stabilizes near-cognate codon:anti-codon interactions and causes increased rates of 
translational error [191], was used to probe for efects on the SU DC. Almost al of 
the regional mutants were sensitive to paromomycin, with especialy strong efects 
sen in the regional arginine mutants, bolstering the hypothesis that charge plays a 
critical role in the stability of the ribosome at the B1b/c intersubunit bridge. In single 
amino acid H109 mutants, H109!, H109E, and H109R were al sensitive to 
paromomycin, while the remaining mutants were comparable to wild-type cells 
(Figure 31B). Anisomycin competes with the 3? end of the a-tRNA for the A-site 
pocket of the ribosome [192,193]. Again, sensitivity was observed in regional 
mutants, with particularly strong efects observed with the 109-111A, 108-110R, and 
 
 
99 
115-117R mutants. Conversely, the single amino acid mutants H109A, H109E, 
H109N, and H109F were al resistant to this drug, with only E108R, H109I, and 
I110R displaying minor sensitivity (Figure 31B). Sparsomycin interferes with 
peptidyl-tRNA binding to the P-site and with peptidyl transfer [193,194]. At 30ug/ml 
of sparsomycin, the 87-90!, 108-110!, 109-111A, 114-110R regional mutants were 
very hypersensitive and the H109!, H109R, H109S, H109I, and H109Q were 
moderately hypersensitive. Conversely, the H109A and H109F mutants were 
sparsomycin-resistant. The mixture of H109 mutants displaying sensitivity as wel as 
resistance to sparsomycin was of particular interest given L11?s close proximity to the 
P-site, and its known interactions with the peptidyl-tRNA through its L11 P-site loop 
[213].  
 The yeast ?kiler? system provides a convenient genetic method to monitor for 
general translational fidelity defects. ?Kiler
+
? yeast contain the dsRNA L-A helper 
virus, and its satelite, M
1
. L-A encodes a capsid protein (Gag), as wel as a Gag-pol 
fusion protein containing the viral replicase, which is synthesized consequent to a -1 
programmed ribosomal frameshift (-1 PRF) [179,195,196]. The M
1
 (+) strand RNA is 
encapsidated and replicated in L-A viral particles, and encodes a secreted toxin that 
can kil uninfected yeast through its interaction with the Kre1p cel wal asembly 
protein [197]. Maintenance of M
1
 is highly sensitive to alterations in translational 
fidelity, and the inability of cels to maintain M
1
 can be scored by loss of the ?kiler? 
phenotype, i.e. loss of a zone of growth inhibition around Kiler
+
 cels when plated 
onto a lawn of diploid Kiler
#
 indicator cels. Six of the 14 regional mutants as well as 
the H109E and H109N mutants exhibited Kiler
#
 phenotypes (Figure 31C). 
 
 
100 
Additionaly, several of the H109 mutants and the 115-117A regional mutant 
conferred weak kiler phenotypes (Kiler
W
) as defined by decreased zones of growth 
inhibition. Of note, the strongest efects on Kiler maintenance are observed in strains 
in which amino acids were either deleted, or in which the charges of their side-chains 
were altered. As L11 is located in the intersubunit cleft, polysome profiles were 
generated for most of the mutant strains to determine whether the observed 
phenotypes could have been caused by ribosome biogenesis or subunit joining 
defects, which are known to negatively impact on Kiler virus maintenance [220]. Al 
of the mutants exhibited wild-type polysome profiles (data not shown).  
  
Changes to the B1b/c bridge affect translational fidelity 
 ?Translational fidelity? genericaly refers to the acuracy of protein synthesis. 
A series of bicistronic Renila-firefly dual luciferase reporters were used to 
quantifiably examine 4 diferent aspects of translational fidelity: -1 PRF, +1 PRF, 
suppresion of a nonsense UA codon, reviewed in [180], and utilization of a near-
cognate codon (reviewed in [184]). Regional mutant 109-111A and a subset of the 
H109 mutants (H109!, H109A, H109E, H109R, and H109F) were selected for these 
analyses based on their location in relation to lethal mutation 109-111R and their 
strong genetic phenotypes. -1 PRF rates were measured using the L-A dsRNA -1 PRF 
viral signal positioned betwen two luciferase genes. Ratios of fusion luciferase 
proteins were compared to a 0-Frame control with the luciferase genes in frame with 
each other. Wild-type rates of -1PRF were 6.07% ?0.16%, i.e. within the normal 
range of other ?wild-type? strains examined in our laboratory of 4-8%, (see 
 
 
101 
[180,185]). Several mutants conferred statisticaly significant changes in -1 PRF, 
including 87-90R, 108-110R, H109%, H109E, H109R, and 114-116R (Figure 32).  
 
 
Figure 32. The L1 B1b/c bridge mutants afect translational fidelity. 
Isogenic yeast cels expresing either wild-type or mutant forms of L1B were transformed with dual 
luciferase reporters and control plasmids and rates of translational recoding wer detrmined. Al 
results are graphed as fold wild-type. -1 PRF was measured using the yeast L-A virus frameshift 
signal. +1 PRF was directed by the frameshift signal derived from the Ty1 retrotransposable element. 
Nonsense suppresion measures the percentage of ribosomes suppresing an in-frame UA 
termination codon positioned betwen the Renila and firefly luciferase reporter gens. Misense 
supression rates evaluated near-cognate utilization of a tRNA
Arg
 tRNA at an AGC serine codon at 
position 218 within the firefly luciferase gene. Eror bars denote standard eror. Asterisks above 
samples indicate statistically significant changes as determined by t-test.  
 
 -1 PRF occurs on ribosomes with tRNAs occupying both the A- and P-sites, 
while +1 PRF occurs when the A-site is empty, thus providing information about 
ribosome fidelity at diferent steps of the translation elongation cycle [132,140]. 
Rates of +1 PRF were determined using a cis-acting signal obtained from the 
 
 
102 
retrotransposon Ty1. +1 PRF rates in cels expresing wild-type RPL11B were 
10.98% + 0.30%. Changes in mutants were generaly mild, although increases in the 
109-111A, H109A, and 114-116R mutants, and decreases observed in H109R, and 
H109F were statisticaly significant (Figure 32). 
 Codon recognition occurs in the DC of the SSU, and is another critical 
component of translational fidelity. While paromomycin is a good genetic indicator of 
altered DC function, measuring rates of both nonsense codon suppresion as wel as 
misense incorporation of near cognate amino acids offers more precise and specific 
evaluations of DC fidelity. Suppresion of a UA stop codon immediately upstream 
of the firefly luciferase gene was 0.137% ? 0.003% in cels expresing wild-type L11. 
Al strains tested showed altered rates of nonsense suppresion: the 109-111A, 
H109!, and H109E al trended higher (~1.8-2.0 fold increases), while H109A, 
H109R, and H109F al promoted increased acuracy of UA decoding. Misense 
rates were measured by the incorporation of the near cognate tRNA
Arg
 at a mutant 
AGC serine codon at amino acid 218 of the firefly luciferase reporter, which rescues 
the activity of this enzyme. Misense rates for wild-type were 0.074% + 0.002, 
consistent with previous studies [184]. While the 87-90R and H109F mutants 
promoted wild-type levels of misense incorporation, the remaining mutants 
promoted increased rates of misense suppresion with 109-111A having the highest 
at ~3-fold wild-type (Figure 32). 
 
 
 
103 
B1b/c bridge mutants alter tRNA binding 
Several regional arginine and H109 mutants were selected for tRNA binding 
studies based on their strong genetic phenotypes. To monitor binding of a-tRNA to 
the A-site, puromycin treated salt washed ribosomes were pre-incubated with soluble 
binding factors [189], polyuridine, and yeast tRNA
Phe
 to block the P-site, and were 
subsequently mixed with 2-fold dilutions of yeast [
14
C]Phe-tRNA
Phe
. Complexes were 
bound to and washed on nitrocelulose filters and tRNA binding was determined by 
scintilation counting. Disociation constants were calculated using Graphpad Prism?s 
one site binding with ligand depletion formula. Wild-type K
D
 values for A-site tRNA 
were 97.6 nM ? 12.2. While 109-111A, H109A, H109F, and 114-116R mutant 
ribosomes al maintained wild-type binding constants, 87-90R, 108-110R, and H109E 
ribosomes promoted decreased afinities for A-site tRNA, with H109E increasing its 
K
D
 to the greatest extent (176.5 nM ? 16.3) (Figure 33A).  
 P-site tRNA K
D
s were evaluated in a similar manner with polyU primed 
puromycin treated salt washed ribosomes incubated with varying concentrations of 
[
14
C]Ac-Phe-tRNA
Phe
. As expected, the wild-type K
D
 value of 72.3 nM ? 7.9 for P-
site binding was lower than A-site. Similar to the A-site binding results, 109-111A 
and H109A ribosomes displayed roughly wild-type values, as did 108-110R. Both 87-
90R and H109F conferred higher K
D
s (122.2 nM ? 9.3 and 99.2 nM ? 5.0 
respectively). Both 114-116R and H109E promoted higher binding afinities for P-
site tRNA with K
D
 values of 41.0 nM ?10.1 and 42.8 nM ? 11.2 respectively (Figure 
33B). 
 
 
 
104 
 
Figure 33. The L1B mutants afect disociation constants for tRNAs. 
(A) Binding of tRNA to the A-site. Logarithmic and linear X-axis shown. Ribosomal P-sites were 
blocked with tRNA
Phe
 at 30? C, then incubated for 35 minutes with [
14
C]Phe-tRNA plus elongation 
factors and poly(U). 80S-tRNA-poly(U) complexes were bound to nitrocelulose filters and washed 
with binding bufer. Samples were read by radioactive scintilation counting. Curves were generated 
using GraphPad Prism 4. (B) A-site tRNA binding K
D
s were determined using one site binding with 
ligand depletion equation. Eror bars show standard error of variables calculated from three binding 
reactions per strain. (C) Binding of tRNA to the P-site. Logarithmic and linear X-axis shown. 12.5 
pmoles of salt washed ribosomes (417 nM) were incubated for 40 minutes at 30? C with dilutions of N-
acetylated-[
14
C]Phe-tRNA and poly(U) and procesed as described for A-site binding. (D) K
D
s for P-
site tRNA binding. Eror bars show standard error of variables calculated from six binding reactions 
for wild type and thre per mutant strain. 
 
Ribosome structural conformations are influenced by the B1b/c bridge. 
Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) using 
the chemical probe 1M7 [200,201,202] was utilized to explore the role of the B1b/c 
bridge mutants on rRNA conformation and the role of L11 as an informational 
conduit betwen distinct regions of the LSU and SU. SHAPE modification 
incrementaly modifies rRNA base sugar backbones in proportion to their flexibility. 
 
 
105 
Modified (solvent acesible and flexible) bases are visualized as strong stops 
produced by reverse transcriptase primer extension reactions relative to unmodified 
samples. In this manner, changes in the levels of flexibility of rRNA bases 
consequent to L11 mutations can be discerned using SHAPE. As most ribosomal 
rRNA bases are naturaly protected from 1M7, changes observed in comparing wild-
type to mutant ribosomes preferentialy appeared as deprotections. In this study, 
approximately one third of the ribosomal rRNA was interrogated spanning the 5S, 
25S, and 18S rRNAs focusing on those regions closest to L11, the A- and P-site 
tRNA binding pockets, the PTC, and the DC (se Figure 27 in Chapter 2). Each 
mutant asayed for tRNA binding was asayed by SHAPE. The results are shown in 
Figure 34. The 109-111A and H109A mutants did not show any changes as compared 
to wild-type ribosomes. While several changes were observed in the H109E and 114-
116R mutants, the 87-90R, 108-110R, and H109F mutants displayed numerous 
changes in rRNA structure, many of which were overlapping. These changes are 
mapped to both the 2- and 3-dimensional structures in Figure 35, while Table 4 lists 
these bases along with their E. coli equivalents. Examination of Figure 35 reveals that 
the majority of changes in rRNA base modifications were concentrated in 3 or 4 
regions of the ribosome. The mutants tended to alter rRNA residues in the terminal 
loop of Helix 84, which contacts L11. The terminal loops of Helices 82 and 80, as 
wel as unpaired bases connecting Helix 82 with Helix 83, and flanking Helix 88 
were similarly altered. These modified bases lie on top of the LSU tRNA binding 
pocket. The terminal loop of Helix 39, which interacts with 5S rRNA and ribosomal 
protein L10, also showed extensive changes in base modification. Numerous changes 
 
 
106 
were also observed in the core of the PTC centered around A2820 (E. coli A2451), 
and the H109F mutant promoted increased reactivity of U2827 ? G2829, which 
interact with the N-terminal extension of ribosomal protein L10 [209]. In the SSU, 
significant changes in 1M7 reactivity were observed in 18S rRNA bases C1465, 
C1467-C1470, and C1571, which are located betwen the ribosomal protein S18 
binding site [12] and the DC. A number of individual bases relatively distantly 
removed from the mutated B1b/c bridge region also displayed altered protection 
profiles, including C827, U828, A974, U1380, G1419, U1419, C1482, and C1485. It 
is likely other such changes exist, but were not interrogated in the current study. 
 
 
 
107 
 
 
Figure 34. L1 mutants promote local and distant changes in rRNA structure. 
 
(A) 1M7 SHAPE modification of 25S rRNA for wild-type and mutant puromycin treated salt washed 
ribosomes. DMSO lanes are unmodified controls. Sequencing laders are shown to the left of each 
panel. (B) SHAPE modification for 18S rRNA for same mutant ribosomes. Al mutants were probed 
multiple times, and representative images are presented. 
 
 
108 
 
Figure 35. Location of altered rRNA bases. 
(A) Location of altered bases in two dimensional structure of 25S rRNA, and (B) in the 18S rRNA. (C) 
Position of structural changes in thre dimensional structure of the ribosome in two separate views. 
Light blue surface is LSU rRNA, deper blue surface are proteins, 5S rRNA is purple, light gray 
surface is 18S rRNA, darker gray are proteins. The E, P, and A site tRNAs are orange, black, and dep 
blue respectively. L11 is in cyan, S18 in yellow, H84 plus extension is lime-yelow. Deprotected bases 
are shown as red spheres, while bases with increased levels of protection are green spheres. 
 
 
 
109 
 
Table 4. RNA base modification resulting from L1 mutations analyzed by SHAPE. 
 
 
Discusion 
During translocation, the head of the SU and the CP of the LSU undergo 
large conformational changes [7,8,169]. The B1b/c bridge, which is formed by L11 
and S18, is at the center of this structural rearrangement, and thus this bridge may 
serve as a conduit for information exchange among the diferent functional centers in 
both subunits. The L11 mutants analyzed in the current study are useful not only for 
 
 
110 
testing the hypothesis that the bridge functions as a molecular ruler, but also to map 
the alosteric information transmision pathways within this complex and dynamic 
molecular machine. Inspection of Figure 30A reveals that H84 of the LSU is nestled 
in betwen two distinct structural elements of L11: the intersubunit bridge region and 
a structure caled the ?P-site loop,? which has been shown to help the ribosome 
monitor the tRNA occupancy status of the ribosomal P-site [213]. Local to L11, 
deprotection of the terminal end of H84 from chemical atack by the 108-110R and 
H109F mutants, which lie on the opposing side of H84 relative to the P-site loop, 
suggests that structural changes occurring at the intersubunit B1b/c bridge can shift 
the dynamic equilibrium of the P-site loop to favor the ?P-site empty? state of the 
ribosome with H84 serving as the intermediary betwen these two regions of L11. 
Thus, the H84 structural changes caused by many of the mutants asayed in the 
current study suggest that L11 and H84 work together to communicate information 
pertaining to the status of the P-site and the B1b/c bridge.  
Intriguingly, while mutants in the P-site loop of L11 only conferred local 
changes in 25S rRNA, the B1b/c bridge mutants had wider-ranging efects. H84 
forms the distal end of an ?L-shaped? joint, the long axis of which is comprised of 
Helices 83, 82, and 80. This axis frames the top of the tRNA binding pocket in the 
LSU from the peptidyl-tRNA T-loop al the way to the PTC. The observation of 
numerous changes in the rRNA modification paterns along this axis suggests that 
H84 may be a molecular lever, transmiting information pertaining to the status of the 
B1b/c bridge through the tRNA binding pocket to the PTC. However, deprotection of 
H84 cannot be the only explanation of the subsequent deprotection of these 
 
 
111 
structures, as the 87-90R mutant promoted deprotection of these regions with no 
corresponding changes in H84. Importantly, many of the mutants (87-90R, 108-110R 
and H109F) promoted changes in the terminal loop of H39. This structure is 
contacted by ribosomal protein L10 (Figure 35, Figure 36) which has been proposed 
to play an important role in coordinating tRNA pasage through the ribosome [209]. 
L10 interacts with bases in H89 involved in formation of the a-tRNA 
acommodation corridor, the peptidyl-tRNA in the PTC, and with 5S rRNA [12]. 
Interestingly, the chemical protection paterns of A2819 and G2828 were also altered 
in the Y11C mutant of L10 [209], and G2828 was afected in mutants of the N-
terminal extension of ribosomal protein L3 [221], suggesting a degree of molecular 
crosstalk betwen L11 located in the intersubunit face of the CP, and L3/L10 which 
influence the elongation factor binding site on the LSU and the PTC. Similarly, 
G2823 and U2827 were afected in C2819U (25S rRNA PTC) mutant ribosomes 
[210]. These shared changes in rRNA chemical protection paterns suggest that, while 
spatialy remote, al of these diferent regions of the ribosome are informationaly 
connected through specific nucleotides. 5S rRNA has also been implicated in 
information exchange through the LSU [222]. While no base modifications were 
observed in 5S rRNA itself, its smal size prohibited acurate chemical probing 
through much of its length. Further, the presence of a flexible three-way junction in 
this molecule may enable it to undergo large conformational changes without 
breakage or formation of new base pairs [223], a key atribute for SHAPE 
modification. Nonetheles, the changes in rRNA structure promoted by the L11 B1b/c 
bridge mutants support the hypothesis that 5S rRNA may function as a molecular 
 
 
112 
spring to transmit information pertaining to the B1b/c intersubunit bridge through 
L11 to the other side of the LSU [224]. By this model, conformational changes in L11 
occurring during the ratcheting proces may be transmited through 5S rRNA to L10, 
connecting the ratcheting status of the intersubunit bridge with structures asociated 
with the elongation factors and the PTC. In summary, we propose that L11 may direct 
information flow through the LSU along two diferent alosteric pathways: along the 
top of the tRNA binding pocket via H84, and through 5S rRNA. This is modeled in 
Figure 37.  
 
 
Figure 36. Position of ribosomal protein L10 relative to nearby modified bases. 
Views from two separate angles show L10 and the proximity of its lops to many of the base changes 
observed in various L11 B1b/c bridge mutants. Red spheres indicate bases with decreased 
protection/increased flexibility, while gren represent increased protection. 
 
 
 
 
 
 
113 
 
Figure 37. Proposed ?wiring diagram? model of allosteric information flow through the B1b/c 
intersubunit bridge. 
Overlaid arows depict communication pathways connecting the decoding center (DC) in the SU to 
the PTC in the LSU. Coloration is identical to that used in Figure 6C. 
 
Chemical protection analyses were also extended to the SU in the current 
study, identifying a cluster of changes in 18S rRNA centered on the region located 
betwen S18 and the DC. These observations indicate that disruptions to the LSU side 
of the B1b/c bridge also have a direct efect on the local rRNA structure of the SU, 
possibly disrupting information flow betwen the DC and the LSU (Figure 35 and 
 
 
114 
Figure 37). These local and distant concentrations of structural variations begin to 
map the alosteric information exchange pathways betwen the major functional 
centers in both the LSU and the SSU that are linked through the B1b/c bridge.  
 A significant number of indirect base modification changes were also 
observed in both ribosomal subunits. These include A1102-A1103 in the LSU, and 
C827-U828, A974, U1380, G1419, U1423, C1482, and C1485 in the SU. With no 
obvious physical connections betwen these bases or with the B1b/c bridge region, 
their significance is dificult to ascertain. C827-U828 are located in the eukaryotic 
specific ES6. This region of the 18S rRNA, recently visualized by X-ray 
crystalography of the yeast ribosome, exists as an extended helix on the solvent side 
of the SU starting below the platform [1]. ES6 is involved in two eukaryotic specific 
intersubunit bridges: eB11 at its tip, in conjunction with ES41 of the LSU, and eB12 
at its base, together with protein L19e [1]. This suggests that C827-U828 
modification is either the direct result of conformation changes in the eB12 bridge or 
an indirect efect of alterations in the eB11 bridge. A recent cryo-EM study 
demonstrated that ribosomes are thermodynamicaly unconstrained at physiological 
temperature and can asume ~50 distinct ribosomal and tRNA conformations [13]. 
Thus, one explanation for the indirect efects of the L11 B1b/c bridge mutants may be 
that disruption of the bridge drives the empty ribosomes to one or another preferred 
conformational state, e.g. pre- or post-translocation, thus altering the exposure of such 
remote peripheral bases to 1M7 modification. Likely, both direct and indirect 
alterations, at times diferent for each mutant, represent a preference for one or more 
of these 50 states, and in this manner bolster the notion that a proper diferential 
 
 
115 
charge of the B1b/c bridge is esential for maintaining the proper equilibrium of the 
ribosome as a Brownian nano-machine, especialy when tRNAs are absent. 
Consistent with this, the most significant structural changes were observed in the 
mutations that directly altered the amino acid side-chain charge properties. For 
example, while the only lethal mutant was 109-111R, and the 87-90R, 108-110R, 
114-116R, and H109E mutants conferred significant changes in rRNA structure, the 
single (H109A) or multiple (109-111A) neutral-charge mutations had no discernable 
effects. This also indicates a significant degree of redundancy built into the 
intersubunit L11-S18 bridge, as simply voiding a portion of the charge was not potent 
enough to grossly afect rRNA structure. While structural alterations were observed 
in H109F, this may be due to the loss of the positively charged histidine replaced by 
the addition of the bulky phenylalanine side-chain which may inhibit the smooth 
gliding movement betwen L11 and S18 during ribosome ratcheting.  
Changes in ribosome structure impact its biochemistry. For example, the 87-
90R, 108-110R, H109E, and H109F mutants promoted significant structural changes, 
which were functionaly reflected by alterations in afinities for either the A-site 
tRNA, the P-site tRNA, or both. In contrast, both the 109-111A and H109A mutants 
had minimal efects on rRNA structure, with corresponding wild-type rates of tRNA 
binding. Given the unique rRNA modification profile of each mutant, it is not 
possible to atribute any one set of rRNA structural changes to the specific efects on 
tRNA afinities. However, A2819 and A2820, which lie in the core of the PTC, were 
exclusively more protected in the 87-90R, 108-110R, and H109E mutants, and thus it 
is possible that this structural change may contribute to the observation that these 
 
 
116 
mutants al conferred increased disociation constants for a-tRNA binding to the A-
site. H109E also promoted increased afinity for Ac-aa-tRNA in the P-site and 
conferred the largest number of rRNA base protection changes in the 18S rRNA. It is 
possible that this mutant conferred the most extreme state defect on ribosome 
ratcheting, driving the equilibrium most strongly to the pre-translocation state.  
Structural changes also impact ribosome function. As a gross monitor of 
changes in translational fidelity, the Kiler asay revealed that the L11 mutants that 
most afected the charge properties in the B1b/c bridge had the greatest efects on 
Kiler virus maintenance. For example, while the 87-90R, 108-110R, and 114-116R 
mutants were al unable to maintain the Kiler virus, their alanine-mutant counterparts 
al remained Kiler
+
. Indeed, while most of the H109 mutants maintained the Kiler 
phenotype, including H109R which retained a positive charge, H109E was Kiler
-
. 
These observations loosely correlated with changes in -1 PRF, with the Kiler
+
 109-
111A, H109A, and H109F mutants al promoting wild-type rates of -1 PRF. In 
contrast, the 87-90R, 108-110R, H109E, and 114-116R mutants were al Kiler
-
 and 
displayed statisticaly significant changes in rates of -1 PRF. Exceptions were the 
H109% and H109R mutants, both of which promoted decreased rates of -1 PRF yet 
maintained Kiler, suggesting that additional proceses are involved.  
A narrower look at translational fidelity reveals numerous mutant-specific 
efects, i.e. in -1 PRF, +1 PRF, and the ability of the ribosome to properly identify 
nonsense and misense codons. Most of the mutants promoted increased rates of 
misense suppresion, potentialy corresponding to increased sensitivity to 
paromomycin, which helps stabilize near-cognate codon:anti-codon interactions. In 
 
 
117 
examining the general viability of the mutant yeast strains, slow growth phenotypes 
observed at the optimal temperature of 30? C were further aggravated at colder 
temperature, while most strains beter resembled their wild-type counterpart at the 
higher temperature. Lower temperatures decrease entropy, thus decreasing Brownian 
motion and intermolecular collision rates. In contrast, entropy is greater at higher 
temperatures, increasing rates of intramolecular unfolding. The cold-sensitive growth 
phenotypes observed here suggest that these mutants afected inter-molecular 
interactions, i.e. interactions betwen diferent components of the ribosome, rather 
than the folding of L11 itself. This is consistent with the widespread changes in rRNA 
structure discussed above. While the least healthy strains tended to be those afecting 
amino acid side-chain charge properties, particularly in the presence of paromomycin 
and anisomycin, clearly other strains break these loose rules, and it is likely that 
other, unknown factors contribute to the overal growth and health of cels. Thus, we 
propose that the B1b/c bridge region of L11 acts les like a digital ?on/off? switch 
with respect to its role in coordinating intersubunit ratcheting, but rather more like an 
analog ?dimer-switch? or ?rheostat,? potentialy helping to guide the ribosome 
through a series of distinct conformational states.  
In sum, we propose that, by tampering with the diferentialy charged region 
of L11?s B1b/c intersubunit bridge region, we have altered the ability of the 
ribosomal subunits to fluidly transition betwen the pre- and post-ratchet states. This 
may be by increasing the activation energy required to move betwen states, 
explaining why the mutants tended to be more fit at higher temperature, or by locking 
the ribosome in sub-optimal intermediate ratchet states. This structural disruption had 
 
 
118 
a cascading efect on both biochemical and translational fidelity. In disrupting this 
communication pathway we have identified several distinct regions across the 
subunits linked with one another through the B1b/c bridge. We have also provided the 
first experimental evidence, to our knowledge, showing the importance of diferential 
charges in the B1b/c bridge. Future structural analyses of ribosomes arrested at 
diferent steps of the translation elongation program wil atempt to precisely 
correlate specific defects in ribosome conformation with translational fidelity and cel 
growth phenotypes. Additional studies wil employ a similar molecular genetics 
approach to explore this informational pathway from the SU side through L11?s 
protein partner S18 and neighboring S15. 
 
 
 
 
 
119 
 
Chapter 4 
L11 helps mediate subunit joining during ribosomal initiation 
Introduction 
 The eukaryotic ribosome is a complex macromolecule responsible for the 
translation of mRNA into proteins. Comprised of four rRNA molecules and 79 
proteins organized into the large (60S) and smal (40S) subunits, acurate asembly of 
the ribosome is critical for its proper function. During canonical translation initiation, 
40S subunits are complexed with Met-tRNA
Met
i 
in their P-sites with the help of eIF1, 
eIF1A, eIF3, eIF5, and eIF2:GTP, forming the 43S pre-initiation complex (reviewed 
in [37]). The 43S particle is loaded onto the 5? end of the mRNA, asisted by the 
eIF4F complex and PABP, resulting in the 48S particle [39]. ATP-dependent eIF1 
and eIF1A coordinate 5? to 3? 48S scanning of the mRNA to the AUG start codon 
[49,50]. Upon proper alignment of the AUG start codon with the anticodon of the 
initiator tRNA, eIF2 and eIF5 induce GTP hydrolysis, followed by the disociation of 
al eIFs, except for eIF1A. Recruitment of the 60S to the SU is mediated by 
eIF5B:GTP, which binds to the intersubunit surface of the 60S particle [51,52,53]. 
Upon subunit joining, hydrolysis of the GTP molecule enables the disociation of 
both eIF5B and eIF1A, producing the complete 80S ribosome positioned at the start 
codon with the Met-tRNA
Met
i
 in the P-site [54]. Translation elongation proceds from 
this stage, with the ribosome moving along the mRNA in the 3? direction, 
coordinating tRNA binding, peptidyl transfer, and eventual termination at a stop 
codon.  
 
 
120 
 The recent availability of atomic resolution images of the ribosome have 
enabled localization of its constituent parts. These models provide maps for detailed 
studies addresing questions pertaining to how interactions betwen key structural 
elements afect ribosome function. Our laboratory has used these maps to examine 
the roles of specific rRNAs and ribosomal proteins to understand how they mediate 
information flow through the ribosome [204,205,209,210,213,221,222,225]. In the 
current study we further explore the functional role that the esential ribosomal 
protein L11 (L5 in Bacteria and Archaea) plays in both translation initiation and 
elongation. During yeast 60S asembly, L11 forms a complex with 5S rRNA and 
ribosomal protein L5 (L18 in Bacteria and Archaea) via the asembly factor Rrs1p 
[226]. This complex is transported into the nucleolus where it asociates with the 66S 
pre-ribosomal particle prior to cytoplasmic export and final maturation into the 60S 
LSU. Within the LSU, L11 shares contacts with 5S rRNA and H84 of the 25S rRNA, 
and is located at the intersubunit face of the CP (Figure 38). L11 also interacts with 
the P-site tRNA through the L11 ?P-site loop? and forms the only protein-protein 
intersubunit bridge with ribosomal protein S18 (S13 in Bacteria and Archaea) 
[9,12,65,213]. 
 
 
121 
 
Figure 38. L1?s position within the ribosome. 
(A) Crown view of the yeast ribosome LSU. 25S rRNA in gray, unlabeled ribosomal proteins are in 
blue. L11 (cyan) is positioned at the intersubunit cleft, located in the CP of the LSU where it interacts 
with 5S rRNA, Helix 84 of 25S rRNA, and the T-loop of the peptidyl-tRNA. PTC, peptidyl transferase 
center. (B) Close-up view of L11 and neighboring structures. Amino acids of L11?s core region 
targeted for mutation are shown in spheres with side chains as lines. Ribosomal structures generated in 
PyMol using yeast cryo-EM [12] with tRNAs from T. thermophilus [65]. tRNAs were docked to 
ribosome using rpS18 as an ?anchor? in a tRNAs+S18 object using S18 alignment feature of PyMol. T. 
thermophilus S18 was then hiden for purposes of image generation. 
 
 The yeast Saccharomyces cerevisiae underwent a genome duplication event 
approximately 100 milion years ago [227,228]. While the majority of replicated 
genes were lost, duplicates of most ribosomal protein genes were retained. L11 is 
encoded by the paralogous genes RPL11A and RPL11B, located on chromosomes 16 
and 7 respectively [173]. The 19-kDa, 174 amino acids long isoforms are identical 
except for an alanine (L11A) to threonine (L11B) substitution at the third amino acid 
position. While early studies of L11 (a.k.a. L16 prior to standardization of 
nomenclature) in the 1980s and 1990s found the two isoforms to be functionaly 
interchangeable, their expresion levels are not equal, with L11A comprising one 
 
 
122 
third of the total L11 in the cel, and L11B providing the remaining two thirds. While 
expresion of either isoform alone is adequate for cel viability, 60S asembly is 
depresed in both instances. However, while cels expresing only L11B maintain 
wild-type growth rates, those with only L11A display slow growth phenotypes [174]. 
Al mutations and experiments reported in the current study were performed in an 
rpl11A! rpl11B! double deletion strain background in which alelic variants of 
RPL11B were expresed under control of its endogenous promoter from low-copy 
episomal plasmids.  
The current study focuses on critical amino acids located in the core of L11, 
identifying mutants that afect translational fidelity, tRNA binding, and rRNA 
structure, as wel as that negatively impact subunit joining during the proces of 
initiation. The observed initiation defects appear to arise from the disruption of two 
distinct facets of subunit asociation. We propose one model where misfolding of L11 
disrupts subunit joining at the L11-S18 intersubunit bridge, and a second in which the 
transition from initiation to elongation may be depresed by the perturbation of 
60S:eIF5B:GTP binding and/or function. 
 
Materials and Methods 
Most materials and methods including 10-fold dilution spot asays, asays for 
translational fidelity, ribosome/tRNA binding, and rRNA structural analyses were 
previously described in a recent publication [213]. Oligonucleotide primers used for 
generation of L11 bridge mutants are listed in Appendix C, Table 7. Oligonucleotide 
primers used for structural analysis by SHAPE [202], dimethyl sulfate (DMS), 1-
 
 
123 
cyclohexyl-3-(2-morpholinoethyl) carbodiimide metho-p-toluene (CMCT), and 
kethoxal are listed in Chapter 2, Table 2. Methods for chemical modification and 
analysis by reverse transcription primer extension using DMS, CMCT, and kethoxal 
were performed as previously described [229]. The published structures for the 70S 
ribosome from E. coli (PDB acesion numbers: 2AVY, 2AW4; [15]), as wel as 80S 
structures from yeast (3JYV, 3JYW, 3JYX; [5,12]) were used in the analysis of this 
work and the generation of figures. Published Thermus thermophilus 70S subunits 
containing A-site, P-site, and E-site Phe-tRNAs were also employed (1G1X [65]). Al 
structures were visualized and manipulated using MacPyMol software [190]. 
 
Sucrose density gradient fractionation.  
Yeast cells were grown in YPAD to mid-log growth phase to OD
600
 of 0.6-1.0 to 
generate polysome profiles, cycloheximide was added to cultures to a final 
concentration of 0.1 mg/ml and cultures were placed on ice for 10 minutes. Cels 
were peleted by centrifugation and washed with polysome lysis buffer (20 mM Tris-
HCl pH 7.0 at room temperature, 50 mM KCl, 12 mM gCl
2
, 1 mM DT, 200 ?g/ml 
cycloheximide). Cels were resuspended in polysome lysis buffer and disrupted using 
Zirconian beads and two 2-minute pulses using a minibead beater. Lysates were 
clarified by centrifugation. Aliquots of 6.5 absorption units at OD
260
 were frozen at -
80? C. Aliquots were layered on top of 10.5 ml 7 - 47% sucrose gradients (polysome 
lysis buffer with 7-47% weight/volume sucrose). Gradients were centrifuged at 
40,000 rpm for 100 minutes at 4? C using a Beckman Coulter SW41Ti rotor. After 
spinning, samples were continuously monitored at 254
 
nm using an ISCO gradient 
 
 
124 
fractionator Model UA-5. To determine relative ratios of 40S and 60S subunits, cels 
grown to mid-log growth phase were peleted by centrifugation and washed with 4? 
C subunit lysis buffer (50 mM Tris-HCl pH 7.0, 50 mM KCl, 1 mM DT). Cels were 
resuspended in subunit lysis buffer, disrupted and aliquoted as described above. 
Aliquots were layered on top of 10.5 ml of 7-47% sucrose gradients (20 mM Tris-
HCl pH 7.0, 500 mM KCl, 12 mM MgCl
2
, 1 mM DT, 7 - 47% weight/volume 
sucrose). Gradients were centrifuged at 40,000 rpm for 180 minutes at 10? C using a 
Beckman Coulter SW41Ti rotor. Samples were continuously monitored at 254
 
nm 
using an ISCO gradient fractionator Model UA-5. 
 
Results 
Generation of rpL11 alleles and genetic analyses 
Recent studies from our laboratory demonstrated that critical amino acids in 
the ?P-site loop? and in the B11b/c intersubunit bridge regions of L11 participate in 
communicating information from the DC in the SU to the PTC in the LSU 
[213,230]. In both cases, changes in the physical structure of H84 were observed. 
These observations led us to examine a stretch of amino acids of L11 located next to 
H84, extending from R92 located proximal to the intersubunit B1b/c bridge, to F96 
located in the core of L11 (Figure 38B). Within this R
92
DRNF
96
 stretch of amino 
acids, regional alanine, arginine, and deletion mutants of 3 to 5 sequential amino 
acids were generated in a first round of site-directed mutagenesis. This analysis 
revealed two lethal mutants: deletion of this entire stretch of amino acids (R
92
DRNF
96
 
! !), and substitution to poly-arginine (D
93
RNF
96
 ! R
93
RRR
96
). This was followed 
 
 
125 
up by a second round of mutagenesis focusing on R92 and F96 due to their location 
within L11 relative to the B1b/c intersubunit bridge region and H84 (R92), or their 
universal conservation (F96) (Figure 39). A prior random mutagenesis screen also 
identified A66D as resistant to anisomycin. This mutation is located on the opposite 
side of, yet stil adjacent to H84 and is also discussed in this study (Figure 38B). 
 
 
 
 
126 
Figure 39. Multiple sequence alignment of L1. 
Black boxes indicate L11 core amino acids targetd for mutagenesi. Red boxes indicate previous 
B1b/c bridge mutation sites. Blue box indicated previous P-site lop mutation sites. Amino acid colors: 
red: smal; blue: acidic; magenta: basic; green: hydroxyl, amine, basic, Q. 
 
The regional mutants R
92
DRNF
96
 to A
92
AAAA
96
 (92-6A, nomenclature used 
throughout), and 93-5A were both viable, as were al other single amino acid mutants. 
Growth phenotypes were monitored by standard 10-fold dilution spot analysis on SD-
trp media. As baseline growth phenotypes under ideal conditions were determined at 
30? C, phenotypic changes at alternative temperatures and conditions were compared 
to this standard. At 30? C, 93-5A caused a smal reduction in growth, as did R92K, 
R92I, R92Q, F96!, F96S, F96Q, and F96W. More severe growth impairment was 
observed in the F96R, and F96E mutants (Figure 40A). Changes in ribosome function 
are often exacerbated by warmer or colder temperatures due to changes in the 
thermodynamic and/or kinetic conditions in which inter- and intramolecular 
interactions occur. At 20? C kinetics are slowed, and most strains maintained their 
growth rates relative to wild-type as observed at 30? C, with the exception of 92-6A 
and F96E, both of which grew slightly beter at the lower temperature as compared to 
30? C (Figure 40A). At 37? C wild-type growths rates were restored in the 93-5A, 
R92K, and F96W mutants. In contrast, decreased growth was observed in 92-6A, 
F96!, F96R, F96E, F96S, F96Q, F96N, and F96H (Figure 40A).  
 
 
 
127 
 
Figure 40. Phenotypic analyses of the viable L11 mutants. 
(A) 10-fold dilutions of yeast strains were spoted onto SD-Trp media and incubated at temperatures 
indicated, or (B) on SD-Trp media containing paromomycin, anisomycin, or sparsomycin at the 
indicated concentration and grown at 30? C. (C) Kiler virus asays. Wild-type (WT) Killer
+
 cels are 
identified by a zone of growth inhibition. Inability to maintain the Killer
+
 phenotype indicates altered 
translational fidelity. 
 
Changes afecting the performance of the DC, A-site, and P-site tRNA 
binding pockets can be monitored by growing yeast in the presence of the small-
molecule translational inhibitors paromomycin, anisomycin, and sparsomycin 
respectively. Paromomycin binds to the DC, stabilizing near-cognate codon:anticodon 
interactions, resulting in elevated levels of translational miscoding [191]. Ten-fold 
serialy dilution asays of yeast grown in the presence of 2mg/ml paromomycin 
revealed that the 93-5A mutant promoted a smal degree of resistance to 
paromomycin, the 92-6A and most of the F96 mutants were slightly paromomycin 
hypersensitive, and the R94A and R92 mutants were not afected by this drug (Figure 
40B). Anisomysin binds to the A-site pocket, competing with the 3? end of aa-tRNA, 
 
 
128 
and changes in cel growth in the presence of this drug are suggestive of changes in 
the ribosome?s afinity for aa-tRNA and/or for anisomycin [192,193]. The A66D, 
R92!, R92H, F96!, and F96H mutants were slightly resistant to 40 ?g/ml 
anisomycin, and strong resistance was observed for F96R, F96E, F96S, F96Q, and 
F96W (Figure 40B). Sparsomycin binds to the P-site pocket where it interferes with 
peptidyl transfer as wel as peptidyl-tRNA binding [193,194]. At 30 ?g/ml 
sparsomycin, no changes were observed in either the 92-6A or 93-5A mutants, but 
R94A was slightly hypersensitive, as were al of the R92 mutants (R92S conferring 
the strongest efect). Al of the F96 mutants were similarly sparsomycin 
hypersensitive (Figure 40B). Surprisingly, the F96 single amino acid mutants 
promoted more pronounced sparsomycin hypersensitivity defects than the 92-6A 
mutant. The strong sparsomycin hypersensitivity promoted by the F96 mutants as 
compared to the R94 or R92 mutants support the notion that the universaly 
conserved F96 is important for ribosome stability and function. 
The ability of yeast strains expresing L11 mutants to maintain the yeast 
?kiler? virus provides a rapid, but non-specific asay for changes in translational 
fidelity [195]. The kiler virus is composed of the dsRNA L-A helper virus, and the 
dsRNA M
1
 satelite virus. The M
1
 satellite virus encodes a secreted toxin that targets 
the GPI-anchored Kre1p cel wal asembly protein, kiling yeast lacking L-A and M
1 
as indicated by a zone of growth inhibition produced when Kiler
+
 cels are grown 
adjacent to Kiler
#
 indicator strains [197]. Maintenance of M
1
 is highly sensitive to 
defects in translational fidelity, and in ribosome biogenesis, both of which result in 
reduction or loss of the kiler phenotype (Kiler
w
, or Kiler
-
) [179,196]. The L11 92-
 
 
129 
6A, R92E, R92S, R92H, F96R, F96E, F96S, F96Q, F96H, and A66D mutants al 
promoted the Kiler
-
 phenotype (Figure 40C). The R92! mutant promoted a Killer
w
 
phenotype. 
  
L11 mutations affect translational fidelity 
 Loss of Kiler can be caused by changes in translational fidelity [179]. This 
efect was monitored by asays of -1 PRF, +1 PRF, nonsense 
suppresion/readthrough of a UAA termination codon, and suppresion of an AGC 
serine by a near-cognate tRNA that normaly decodes an AGA arginine codon. Each 
of these tests utilized bicistronic Renila-firefly dual luciferase reporter plasmids. The 
control (readthrough) reporter encodes a Renila-firefly luciferase fusion protein. In 
the -1 PRF reporter plasmid, the firefly coding sequence (CDS) is in the -1 reading 
frame relative to the Renila CDS, and the two are separated by a -1 PRF signal 
derived from yeast L-A virus so that firefly luciferase is only synthesized subsequent 
to a -1 PRF event. In the +1 PRF reporter, the two luciferase CDSs were similarly 
separated by the Ty1 retrotransposon +1 PRF signal, and the firefly CDS was in the 
+1 frame. The nonsense suppresion plasmid encodes for both genes in frame with a 
UA codon in betwen the two CDSs. In the misense suppresion reporter the codon 
for the catalytic arginine
218-AGA
 of the firefly luciferase gene was replaced with an 
AGC for serine, causing the firefly luciferase product to be inactive unles an arginine 
is mistakenly incorporated at this position. Cels were grown to mid-log phase and 
lysates were monitored by using a luminometer. The ratio of ratios was calculated to 
determine the rates for each event [185]. 
 
 
130 
 -1 PRF can proced through at least three distinct kinetic pathways, two 
occurring during translocation events, and one during acommodation of a-tRNA 
into the A-site [132,140]. However, in each case the ribosome?s A- and P-sites are 
occupied by tRNA molecules, and specific mRNA signals such as a slippery 
sequence, spacer region, and mRNA pseudoknot promote the frameshift. Changes in 
the kinetics of translation elongation can afect the partitioning of the ribosome with 
regard to reading frame at the -1 PRF signal. Wild-type rates of -1 PRF were 6.07% 
?0.16%, values that agree with other ?wild-type? strains measured in our laboratory 
(4-8%; se [180,185]). Most of the L11 mutants conferred significant changes in -1 
PRF. The majority of the mutants promoted decreased rates of -1 PRF, though the 
F96Q, F96E, and A66D mutants slightly stimulated this phenomenon (Figure 41). +1 
PRF requires a diferent substrate than -1 PRF (reviewed in [134]), thus providing an 
asay for changes in ribosome function in a diferent biophysical state [231]. +1 PRF 
was 10.98% + 0.30% in wild-type cels, and again most mutants conferred 
statisticaly diferent changes in this parameter, although the extent of these changes 
tended to be smaler than for -1 PRF (Figure 41). However, the F96N mutant 
promoted an ~1.7 fold increase in +1 PRF (18.62% ? 0.6%). Nonsense and misense 
suppresion levels are useful measurements for examining the ability of the ribosome 
to acurately decode and proofread mRNAs. While decoding occurs in the SSU, far 
from L11, recent studies have revealed that the two are connected through an 
informational pathway traversing the B1b/c intersubunit bridge [230]. Wild-type 
levels of nonsense suppresion were 0.137% ? 0.003%, and misense levels were 
0.074% + 0.002. Asays of mutant cels yielded significant changes in these two 
 
 
131 
aspects of translational fidelity, with ranges from 0.5 to 1.3 fold wild-type levels. The 
exceptions were F96Q and A66D, which promoted rates of nonsense suppresion 4.6 
and 15 fold higher than wild-type respectively (Figure 41). While the A66D and 
F96Q results align wel with the observed paromomycin sensitivity data, misense 
suppresion rates were unafected for F96Q, and other paromomycin sensitive 
mutants did not promote elevated levels of nonsense suppresion. 
 
 
Figure 41. L1B mutants alter translational fidelity. 
Isogenic yeast cels expresing either wild-type or mutant forms of L1B were transformed with dual 
luciferase reporters and control plasmids and rates of translational recoding were determined. All 
results are graphed as fold wild-type. -1 PRF was measured using the yeast L-A virus frameshift 
signal. +1 PRF was directed by the frameshift signal derived from the Ty1 retrotransposable element. 
Nonsense supresion measures the percentage of ribosomes supresing an in-frame UA 
termination codon positioned betwen the Renila and firefly luciferase reporter gens. Misense 
supression rates evaluated incorporation of an arginine (AGA) near-cognate amino acid instead of a 
cognate serine (AGC) at the catalytic codon 218 within the firefly luciferase gene. Eror bars denote 
standard eror with WT eror bars factored in. Asterisks above samples indicate statisticaly significant 
changes as determined by t-test.  
 
 
132 
 
The F96, A66D mutants confer subunit joining/ribosome biogenesis defects 
 Polysome profiling was performed to examine whether the efects on kiler 
virus maintenance were related to defects in ribosome biogenesis or translation 
initiation. Yeast cells were grown to mid-log phase and translation was arrested with 
cycloheximide. Lysates were clarified, sedimented through sucrose gradients (7% - 
47%), and monitored by continuous spectrophotometry (Figure 42). The first two 
peaks correspond to the 40S and 60S subunits respectively. Due to the fact that the 
parental yeast strain lacked the gene encoding the paralogous ribosomal protein 
L11A, the 60S subunit peaks were smaler than true wild-type levels, although 
previous work demonstrated that this level of reduction does not in itself negatively 
impact cel viability or growth rates [174]. Further down the gradient (to the right of 
the 60S peak) is the 80S ribosome peak, followed by peaks corresponding to the 
polysome fractions. The 92-6A mutant and al R92 mutants miicked wild-type 
polysome profiles, but many of the F96 mutants and A66D promoted strong halfmer 
formation evidenced as shoulders or smal second peaks to the right sides of the 80S 
and/or polysome peaks. Halfmers are caused by smal subunits staled on mRNA due 
to a lack of a LSU, and are indicative of 60S subunit ribosome biogenesis defects 
[232]. This can arise from a decrease in the total number of 60S subunits, thus 
slowing down the rate of translation initiation as SSUs stal on the mRNA at AUG 
start codons awaiting a LSU. Alternatively, LSU abundance may not be afected, but 
the changes in L11, which participates in formation of the B1b/c bridge with the SSU 
protein S18, may negatively afect LSU joining during initiation. To diferentiate 
betwen the two models, sucrose density centrifugation was employed to determine 
 
 
133 
the ratios of free 40S and 60S subunits from wild-type and selected mutants. Cels 
were prepared in the same manner as for polysomes, but cycloheximide was omited, 
alowing the majority of translating ribosomes to run off the mRNAs. In addition, 
lysates were sedimented in a buffer containing a higher salt concentration to promote 
subunit disociation, and samples were centrifuged longer to improve peak 
separation. This prolonged spin especialy improved visualization of the 40S peak, 
separating it from celular debris at the top of the gradient as observed at the far left 
of the polysome profiles (Figure 42), which often confound interpretation of the true 
heights of the 40S peaks. Figure 43 shows these subunit profiles, with clearly visible 
40S, 60S, plus a fraction of remaining 80S peaks. As the 80S fraction contains both 
subunits, it can be ignored. Wild-type profiles show that the 60S peak is larger than 
the 40S peak. Comparative analyses showed that subunit profiles of the mutants 
generaly matched the wild-type, with the exception of the F96N mutant. However, 
even in this mutant, the 60S peak was larger than the 40S peak. These data indicate 
that the ratios of 40/60S subunits were not substantialy altered in the halfmer-
promoting mutants, supporting the hypothesis that the L11 mutants afected subunit 
joining opposed to steady-state levels of 60S subunits.  
 
 
 
134 
 
Figure 42. Polysome profiling. 
Cycloheximide arested cel lysates were spun through a sucrose gradient and visualized by continuous 
OD. Example data on previous page. The first peak coresponds to the 40S fraction, then 60S, and the 
highest peak is the 80S, followed by polysome fractions starting with 2-mers, then 3-mers, etc. Bold-
underlined mutants have halfmers, visualized as shoulders or smal peaks to right of primary peaks. 
 
 
Figure 43. Subunit profiling. 
The relative size of 40S versus 60S peaks are unchanged betwen the natural variation sen in wilt-
type cells and those of the mutants. 80S peaks can be ignored as they poses one of each subunit. 
Negative control samples had normal polysome profiles with no halfmers. 
 
 
 
135 
Biochemical and structural analyses 
Changes in rates of PRF and cel growth response to translational inhibitors 
can result from changes in ribosomal afinities to tRNAs. The disociation constant 
betwen a-tRNAs and the ribosomal A-site were determined in vitro by binding 2-
fold serial dilutions of [
14
C]Phe-tRNA
Phe
 to puromycin treated salt washed ribosomes 
pre-loaded with uncharged tRNA
Phe
 in their P-sites, polyU, and supplied with soluble 
binding factors [189]. Wild-type K
D
 values were 103 ? 11 nM. Al mutant strains 
asayed (A66D, 92-6A, F96A, and F96N) had similar K
D
 values (Figure 44A and B). 
P-site tRNA K
D
s were measured by binding serial 2-fold dilutions of Ac-[
14
C]Phe-
tRNA
Phe
 to empty puromycin treated salt washed ribosomes loaded with polyU. Wild-
type ribosomes bound this P-site substrate with a K
D
 of 72.3 ? 7.9 nM (Figure 44C 
and D). The 92-6A and F96A mutants fel within wild-type range. A66D ribosomes 
had a smal but significant increase in K
D
 (89.5 ? 3.8 nM), and F96N promoted a 
smal but significant decrease (48.0 ? 8.3 nM).  
 
 
 
136 
 
Figure 44. A- and P-site tRNA binding K
D
s. 
(A) Binding of tRNA to the A-site. Logarithmic and linear X-axis shown. Ribosomal P-sites were 
blocked with tRNA
Phe
 at 30? C, then incubated for 35 minutes with [
14
C]Phe-tRNA plus elongation 
factors and poly(U). 80S-tRNA-poly(U) complexes were bound to nitrocelulose filters and washed 
with binding bufer. Samples were read by radioactive scintilation counting. Curves were generated 
using GraphPad Prism 4. (B) A-site tRNA binding K
D
s were determined using one site binding with 
ligand depletion equation. Eror bars show standard error of variables calculated from three binding 
reactions per strain. (C) Binding of tRNA to the P-site. Logarithmic and linear X-axis shown. 12.5 
pmoles of salt washed ribosomes (417 nM) were incubated for 40 minutes at 30? C with dilutions of N-
acetylated-[
14
C]Phe-tRNA and poly(U) and procesed as described for A-site binding. (D) K
D
s for P-
site tRNA binding. Eror bars show standard eror of variables calculated from six binding reactions 
for wild type and thre per mutant strain. 
 
Ribosomal RNA chemical protection studies, analyzed by reverse 
transcriptase primer extension visualized by urea-PAGE, were performed to 
determine the efects of selected mutants on rRNA structure. 1M7 SHAPE 
modification was utilized to examine the 92-6A, F96A, and F96N mutants, while 
CMCT, kethoxal, and DMS were employed for the A66D mutant ribosomes. 
Approximately one third of al bases in the 25S, 5S, and 18S rRNAs were 
interrogated using SHAPE (Figure 27). Despite this large area of coverage, no 
 
 
137 
changes were observed in 92-6A, F96A, or F96N ribosomes as compared to wild-type 
(data not shown). However, chemical protection studies of the A66D ribosomes 
revealed that several bases were deprotected from chemical modification relative to 
wild-type (G2677, G3069, and G3116 in H84, H96, and H97 respectively). 
Additionaly, two bases portrayed a patern of increased protection (A2680 and 
G3128 in H84 and H97 respectively) (Figure 45A). The positions of these bases were 
mapped to the two and three dimensional structures of the LSU of the ribosome, and 
are shown in Figure 45B and C. 
 
 
 
138 
 
 
Figure 45. Chemical protection analysis of A6D. 
(A) Base modifications using UN, untreated; DMS, dimethyl sulfate; KET, Kethoxal; and CMCT, 
1=cyclohexyl-3-(2-morpholinoethyl) carbodimide metho-p-toluene; increased deprotection, filled 
triangle; increased protection, empty triangle. (B) Altered bases maped to two dimensional structure 
of 25S rRNA. (C) Changes maped to thre dimensional structure. Gren bases have increased 
protection, red have decreased protection. 
 
 
139 
Discusion  
 Previous mutagenesis studies demonstrated the involvement of L11 in 
communicating information via the B1b/c bridge betwen the DC, located in the SU, 
and the PTC located in the LSU [230]. L11?s ?P-site loop? structure is also involved 
in monitoring and mediating peptidyl tRNA binding to the ribosomal P-site [213]. 
Furthermore, cryo-EM analysis demonstrated that L11 (L5 in bacteria) dynamicaly 
interacts with the E-site tRNA [13]. The current study focused on amino acids located 
in the core of L11, specificaly those located in close proximity to H84 of the 25S 
rRNA. A series of mutants were identified that afected cel viability, translational 
fidelity, ribosome biogenesis, tRNA binding, and rRNA structure. Many of these 
defects are similar to those conferred by previously described L11 mutants located 
either in the P-site loop or in the B1b/c bridge region. While these observations 
suggest that similar mechanistic properties are afected by the L11 core mutants, the 
unique aspect of this clas of mutants is their efect on ribosome biogenesis. Thus, 
these mutants offer additional insight into the role of L11 in the proces of translation 
initiation as wel as during the elongation phase of protein synthesis. 
Both the R92 and F96 amino acids of L11 were mutated to a variety of amino 
acids spanning a range of biochemical properties. While mutants at both positions 
afected celular growth rates and translational fidelity, the strongest genetic 
phenotypes were observed in the F96 mutants. Intriguingly, the 92-6A and 93-5A 
poly-alanine substitutions only promoted moderate efects on cel growth and 
sensitivity to translational inhibitors (Figure 40). While translational fidelity was 
globaly enhanced by the 92-6A mutant (i.e. decreased rates of -1 and +1 PRF, UA 
 
 
140 
termination readthrough and misense suppresion, se Figure 41), correlating with 
the inability to maintain the kiler virus (Figure 40C), this mutant did not afect 
ribosome biogenesis, ribosome asociation with tRNAs, or rRNA structure. The lack 
of correlation betwen functional and biochemical/structural changes was 
unexpected, particularly given the lethality of mutants 92-6! and 93-6R, as wel as 
the variety of efects observed for other single amino acid mutants, particularly 
mutations of F96.  
The subunit joining defects observed here likely stem from one of three 
possibilities. The first posits that mutations alter the intramolecular structure of L11 
which in turn makes the kinetics of subunit joining les favorable. By this scenario, 
al elements required for subunit joining are present at the correct stoichiometric 
levels, but subtle structural defects in L11 decrease the eficiency of subunit joining 
or increase the rate of subunit disociation. Thus, this model proposes that the subunit 
joining defect is the consequence of ineficient interactions betwen 60S and 40S 
subunits. A second possibility is that the structural changes introduced by the A66 or 
F96 mutants may afect eIF5B asociation with the 60S subunit. eIF5B promotes 
recruitment of 60S particles to mRNA bound 40S particles [53], and eIF5B mutants 
negatively impact binding rates of 60S subunits to the 40S subunit [233]. While the 
precise ribosomal binding site for eIF5B is unknown, it is a large GTPase protein 
believed to interact with the GTPase activating center, H80, and the P-site pocket at 
the intersubunit surface of the 60S subunit [234,235]. By this second model, altered 
asociation of eIF5B with the LSU would reduce rates of 80S formation resulting in 
the acumulation of halfmers. A third possibility envisions that, while eIF5B may stil 
 
 
141 
properly bind free 60S subunits and promote formation of 80S ribosomes, mutations 
in the core of L11 may depres the rate of GTP hydrolysis subsequent to subunit 
joining. This could result in staled complexes containing eIF5B:GTP and/or perhaps 
a disociation defect of eIF1A from the ribosome, thus blocking progresion to 
elongation. By this scenario, additional 40S subunits could stil be loaded onto the 
mRNA upstream of the start codon, which would appear as halfmers in polysome 
profiles.  
Al of the F96 halfmer mutants (F96R, F96S, F96Q, and F96N) exhibited 
improved growth at 20? C as compared to the optimal growth condition of 30? C, and 
were hypersensitive at 37? C. In contrast, the halfmer-producing mutant A66D 
maintained wild-type growth rates at al three temperatures. Lower temperatures slow 
the kinetics of a system, reducing entropy and intermolecular collision rates, while 
higher temperatures increase entropy and intramolecular unfolding rates. While the 
A66D mutant conferred both local (H84) and distant (H96 and H97) changes in 
rRNA structure, F96N did not. These data suggest the two mutation sites afected 
diferent aspects of subunit joining. The universaly conserved F96 is physicaly 
closer to the amino acids directly involved in the B1b/c intersubunit bridge than A66. 
Thus, we suggest that the F96 mutations afect L11?s conformation so as to alter 
formation of the B1b/c bridge betwen L11 and S18 without altering 25S rRNA 
structure, following the first model described above. In contrast, the 25S rRNA 
structural changes asociated with the A66D mutant (Figure 45) are more consistent 
with the 60S:eIF5B:GTP interaction inhibition, likely acting through models 2 or 3. It 
should also be noted the level of halfmers in A66D lysates were significantly elevated 
 
 
142 
from those observed in F96 mutants (Figure 42), supporting the hypothesis that these 
two clases of mutants afect subunit joining through diferent mechanisms. 
Intriguingly, previous work identified several temperature sensitive L11 mutants 
(S97F+A98V, S119C+G135D, and G135D) which al displayed halfmers [175]. 
These mutations are either located at the B1b/c intersubunit bridge region of L11 
(S119C), or within a 5? radius of each other and position F96 within the three 
dimensional structure of L11. While these mutations bolster the notion that the B1b/c 
bridge region and the core of L11 is critical for proper subunit joining, a deeper 
characterization of these mutants and their afects on ribosomal structure has not to 
our knowledge been performed.  
 Changes in the orientation of H84 have been linked to altered P-site tRNA 
binding afinities [213,230]. The moderate increase in P-site tRNA K
D
 by A66D 
ribosomes is consistent with this type of defect. This biochemical defect may be due 
to a conformational change in the L11 P-site loop, which is adjacent to A66, and 
which interacts with the T-loop of the peptidyl tRNA. It is also possible that F96N 
may afect positioning of the L11 P-site loop, e.g. drawing it away from the P-site 
pocket and into closer proximity to H84, thereby increasing the ribosome?s afinity 
for the P-site substrate, reflected in its lower K
D
 value (Figure 44). However, direct 
evidence for this is lacking in the rRNA chemical protection studies. 
 Collectively, the investigations described in this study have identified critical 
amino acids in the core of L11 which when altered confer significant defects on 
translational fidelity, both in maintaining proper reading frame, as wel as in the 
ability of the ribosome to diferentiate betwen cognate, near-cognate and termination 
 
 
143 
codons. These efects appear to operate independently of the biogenesis/subunit 
joining defects. These findings add to our growing understanding of the role L11 
plays in the eukaryotic ribosome, and may offer new insights into diseases previously 
linked to mutations in L11, e.g. Daimond-Blackfan anemia [178]. Further 
examination of the structure of L11, particularly regarding mutations of F96 and A66, 
and its relationship with eIF5B are needed to fully unravel the causes underlying the 
observed initiation defects. 
 
 
144 
 
Chapter 5 
Conclusions and Future Directions 
Recent advances in both the quality and quantity of near-atomic resolution 
images, both ?stil-shot? X-ray, and ?videographic? cryo-EM, have enabled improved 
visualization, identification, and localization of the rRNA and protein components 
which are asembled into the ribosome. Such studies have also enhanced our 
knowledge of how specific structural elements move and interact during translation, 
both intra- and inter-molecularly. Furthermore, with examples now available from 
Bacteria, Archaea, and Eukarya, our understanding of which elements are conserved 
and which are variable across the diferent domains of life has increased. These 
studies have opened the door for in-depth evaluations of the relationships betwen 
ribosome structure at the atomic level, and biological function, e.g. translational 
fidelity, and the identification of alosteric communication pathways within the 
ribosome. 
While previous studies identified L11 as an esential protein and localized it 
to the CP of the LSU, L11?s specific functions within the translating ribosome were 
unknown or only hypothesized. In the approximately 100 milion years since the S. 
cerevisiae genome duplication, 16 nucleotide polymorphisms have evolved betwen 
RPL11A and RPL11B, but only 1 amino acid change has arisen (A3T in L11A versus 
L11B) in the 174 amino acid long protein of L11. This degree of conservation 
betwen the two isoforms of L11 over time, especialy at the protein level, suggests a 
critical level of importance for much of the protein sequence. The work documented 
 
 
145 
in this thesis represents the first in depth examination of L11?s role in the translating 
ribosome, and offers insights into how specific structures within the protein 
contribute to the overal function of the ribosome. Examination of L11?s structure 
was divided into three regions: the P-site loop, the intersubunit B1b/c bridge, and the 
H84-interacting core. Using the model organism Saccharomyces cerevisiae, a reverse 
genetics approach was employed which yielded a range of lethal, ?sick,? and healthy 
mutants in each of these three regions. Viable mutants were examined using a number 
of genetic screens including growth rates at high and low temperatures, susceptibility 
to smal molecule translational inhibitors, and ability to maintain the yeast kiler 
virus. Mutants with strong phenotypes were analyzed further using a variety of asays 
examining ribosome biogenesis, translational fidelity, tRNA binding afinities, and 
rRNA structure.  
We have identified the ?P-site loop? of L11 as a dynamic and esential 
structure that monitors the tRNA occupancy status of the ribosomal P-site. When the 
P-site is empty, L11?s P-site loop extends away from H84 and into the P-site, 
increasing the general flexibility of H84 as monitored by 1M7 reactivity. Mutant 54-
7A favors this state as its P-site loop is preferentialy positioned in the extended 
position, resulting in an increase of the peptidyl tRNA K
D
, and a corresponding drop 
in peptidyl transfer rates. Alternatively, upon binding of the P-site substrate, the P-site 
loop is displaced and asociates with H84, decreasing its general flexibility while 
altering its conformation such that base C2675 becomes deprotected. Mutant 51-4A 
mimics this protracted state of the P-site loop, resulting in a decrease of the peptidyl 
tRNA K
D
, and increased rates of peptidyl transfer. As monitored by SHAPE, H84 
 
 
146 
was shown to have increased flexibility in wild-type ribosomes in the absence of P-
site substrate, and decreased flexibility when the P-site was occupied by peptidyl-
tRNA, with the exception of H84 base C2675 whose reactivity increased. These 
findings are in acordance with recent cryo-EM data that visualizes tRNA molecules 
as they progres from the A-site to the E-site through the ribosome [13]. However, the 
resolution of this work (9-20?), was too low to observe the precise movements of 
either H84 or the P-site loop. In addition to afecting tRNA binding, functional 
defects of L11?s P-site loop altered translation fidelity, PRF, growth rates, and 
susceptibility to smal molecule translational inhibitors. 
While the P-site loop appears to monitor the state of the P-site, perhaps 
stabilizing tRNA molecules as they pas by L11, the B1b/c bridge region is involved 
in a communication network betwen the large and smal subunits, linking the PTC to 
the DC. Previous studies identified the B1b/c bridge, the only protein-protein 
interaction betwen the large and smal subunits, as undergoing dynamic structural 
rearrangements betwen the ratcheted and non-ratcheted states, demonstrating large 
bridge transitions from the unratcheted B1b, to the ratcheted B1c configuration. 
While previously theorized, the studies presented in this thesis have experimentaly 
demonstrated that the relative movements of L11 and S18 betwen the B1b/c bridge 
states is mediated by repositioning of diferential charges betwen L11 and S18, and 
that disruption of these charges can inhibit the proper function of the ribosome, even 
to the point of lethality. Using SHAPE analysis we mapped a series of B1b/c bridge 
mutant-dependant rRNA structural rearrangements around the LSU PTC, H84, and 
approaching the DC of the SU, adjacent to S18. These changes enabled us to 
 
 
147 
visualize a communication network reaching from the DC to S18, through the B1b/c 
bridge, up through L11, and then either through H84 or through the 5S rRNA towards 
the PTC. Disruption of this network afected tRNA binding afinities of both the A- 
and P-sites, altered translational fidelity, PRF, and exhibited growth efects at 
difering temperatures and upon exposure to paromomycin, anisomycin, and 
sparsomycin. 
Lastly, we examined the core-H84 interacting region of L11 and found that 
mutations in this region are able to promote biogenesis defects. While large scale 
changes (92-6! and 92-6R) were lethal, 92-6A, and single amino acid mutations in 
this region, as wel as A66D, were al viable. Importantly, numerous mutations at F96 
and in mutant A66D displayed halfmers in their polysome profiles. Upon examination 
of wild-type and mutant subunit ratios, it was determined that the halfmers were not 
due to a discernable deficiency in the production of 60S particles, suggesting that 
changes in L11 resulted in a subunit-joining defect. While no discernable rRNA base 
modifications, as monitored by SHAPE, were observed in mutants 92-6A, F96A, or 
halfmer mutant F96N, the halfmer-promoting mutant A66D conferred several 
changes in base modification paterns. These were located both adjacent to A66D (in 
H84), and far removed (H96-7). While tRNA binding rates were relatively 
unchanged, translational fidelity varied greatly, as did rates of PRF, and growth rates 
at varying temperatures and in the presence of diferent translational inhibitors.  
 In al, we have identified some of L11?s esential roles in the ribosome. These 
include helping to coordinate peptidyl-tRNA interactions, mediating ribosome 
ratcheting and relaying structural signals betwen the large and smal subunits, and 
 
 
148 
playing a role in the eficient asembly of an 80S particle on the mRNA. This new 
insight adds to our understanding of the mechanics of the ribosome and how disparate 
regions are able to coordinate their actions during initiation and elongation. 
Additionaly, the identification of L11 amino acids that alter FS rates offer the 
potential for new drug targets against viruses that utilize PRF for their replication.  
The observation that disruption of the intersubunit B1b/c bridge causes 
changes in the chemical protection paterns of rRNA bases in close proximity to 
ribosomal protein L10 is intriguing. In concert with protein L3, L10 has been 
implicated in mediating a-tRNA aces to the PTC along the acommodation 
corridor [209,221,225]. Our findings with L11 suggest the existence of an 
informational linkage betwen L11 and L10 which asists in coordinating the aces 
of aa-tRNA molecules to the A-site. We suggest that this signaling network also 
involves the 5S rRNA as the molecule that directly connects L11 and L10, as wel as 
the structural network formed by H84-H82-H80 as a second connection betwen L11 
and L10. Given that mutants afecting a-tRNA binding have been identified in both 
L11 and L10 strains, it would be intriguing to create double mutants of these proteins 
in an efort to either correct or exacerbate these features [209,213,230]. Such work 
may asist in teasing apart the relationship betwen these two esential proteins of the 
large subunit.  
 Previous studies in our laboratory have focused on proteins L10, L3, and L2, 
as wel as regions of the 5S and 25S rRNAs. In most of these studies, mutants have 
been identified which afect such biological features as PRF, nonsense and misense 
suppresion, and sensitivity to paromomycin, anisomycin, and sparsomycin. L2, L3, 
 
 
149 
and L10 mutants have been characterized which alter tRNA binding and in some 
cases confer rRNA structural changes as wel. While the argument could be made that 
you only find what you look for, and in each of these cases a similar batery of tests 
was performed, there exists a remarkable level of overlap in translational efects 
induced by alterations in such a wide variety of locations across the ribosome. This 
could be explained with a narrow view, where each of these ribosomal elements play 
a direct role in the proceses so afected, or by a more global view, where the 
ribosome is an interconnected network, much like a spider?s web. In this later view, a 
disturbance in one section of the web can have a rippling efect throughout the 
system, and ultimately a similar set of features can be altered by disturbing multiple 
locations in the network. This global view is the more likely scenario to explain how 
mutations in L11, as wel as in many of these other proteins and rRNAs are afecting 
the ribosome as a whole. In exchange for this diminished view of the direct role of 
each ribosomal element in every proces tested for, a greater understanding of the 
ribosomal network as a whole is unveiled. 
Despite the findings presented here, there remain many features of L11 left to 
be explored. The previously mentioned cryo-EM study by Fischer et al. visualized a 
loop of L11, roughly comprising amino acids S22-R32, which appears to interact with 
the D-loop of the tRNA molecule as it transitions from the P-site to the E-site (Figure 
46) [13]. This interaction may be involved in the intersubunit communication 
network, as wel as stabilizing or guiding tRNA molecules to the E-site. A future 
examination of this loop may prove fruitful in understanding these relationships.  
 
 
 
150 
 
Figure 46. Interaction betwen L1 lop and E-site tRNA. 
Figure adapted from published structures. Left panel shows ribosomal structures generated in PyMol 
using yeast cryo-EM docked into X-ray structure [12] with tRNAs from T. thermophilus [65]. Right 
panel is from cryo-EM [13] by Fischer et al. 
 
We provide strong indirect evidence that L11 and 5S rRNA are joined in an 
informational conduit, but future work should focus on the precise interactions 
betwen these two ribosomal elements. If mutations can be made in the L11-5S rRNA 
region which promote similar structural changes as we observe in our B1b/c mutants, 
this wil help confirm the wiring diagram we have drawn out. Work currently 
underway in our laboratory is examining the B1b/c bridge from the perspective of 
S18, in a similar workflow design as is presented in this work for L11. Mutations 
made to the B1b/c bridge from the S18 side wil be valuable both to confirm 
informational pathways, as wel as to rescue the wild-type phenotype using double 
mutant L11-S18 strains. Techniques such as F?rster resonance energy transfer 
(FRET) could be utilized in order to obtain greater insight into the mechanics of the 
B1b/c bridge during translation. In this procedure, donor and aceptor labels would be 
 
 
151 
atached to L11 and S18 where they asociate. Movements could then be observed by 
measuring fluorescence levels as the ribosome is walked through the various stages of 
elongation by providing tRNAs, eEF1A and eEF2, along with either GTP or GDPNP. 
At this time, these techniques are untried, but future work and/or colaborations may 
provide the opportunity for such analysis. 
 Understanding the intramolecular structural changes of L11 mutants described 
in this study would be highly informative. Such data could potentialy be obtained via 
a comparative analysis of wild-type and mutant L11 crystal structures. Such an 
approach would require isolation of L11 protein, likely through His-6 tagging and 
liquid chromatography, followed by crystalization and X-ray difraction analysis. At 
this time, these techniques are beyond the technical expertise and the required 
equipment needs of our laboratory, but may become available through future 
collaborations. 
 
 
 
152 
Apendix A: Yeast Strain List 
 
Table 5. Yeast strains produced. 
Yeast Strain ID 
Description 
JD1381 (JD1313) Mat alpha ura3-52 leu2D1 trp1D63 his3D200 
rpl11a:HIS3 rpl11b::HIS3 + RPL11B with wild-type UTRs 
on trp based plasmid (pRS314) 
JD1382 
JD1381; Y52! in RPL11B 
JD1383 
JD1381; Y52A in RPL11B 
JD1384 
JD1381; Y52I in RPL11B 
JD1385 
JD1381; Y52S in RPL11B 
JD1386 
JD1381; Y52N in RPL11B 
JD1387 
JD1381; Y52Q in RPL11B 
JD1388 
JD1381; Y52E in RPL11B 
JD1389 
JD1381; Y52R in RPL11B 
JD1390 
JD1381; Y52H in RPL11B 
JD1391 
JD1381; Y52F in RPL11B 
JD1392 
JD1381; R92! in RPL11B 
JD1393 
JD1381; R92A in RPL11B 
JD1394 
JD1381; R92I in RPL11B 
JD1395 
JD1381; R92S in RPL11B 
JD1396 
JD1381; R92N in RPL11B 
JD1397 
JD1381; R92Q in RPL11B 
JD1398 
JD1381; R92E in RPL11B 
JD1399 
JD1381; R92K in RPL11B 
JD1400 
JD1381; R92H in RPL11B 
JD1401 
JD1381; R92F in RPL11B 
JD1402 
JD1381; F96! in RPL11B 
JD1403 
JD1381; F96A in RPL11B 
JD1404 
JD1381; F96I in RPL11B 
JD1405 
JD1381; F96S in RPL11B 
JD1406 
JD1381; F96N in RPL11B 
JD1407 
JD1381; F96Q in RPL11B 
JD1408 
JD1381; F96E in RPL11B 
JD1409 
JD1381; F96R in RPL11B 
JD1410 
JD1381; F96H in RPL11B 
JD1411 
JD1381; F96W in RPL11B 
 
 
153 
Yeast Strain ID 
Description 
JD1412 
JD1381; H109! in RPL11B 
JD1413 
JD1381; H109A in RPL11B 
JD1414 
JD1381; H109I in RPL11B 
JD1415 
JD1381; H109S in RPL11B 
JD1416 
JD1381; H109N in RPL11B 
JD1417 
JD1381; H109Q in RPL11B 
JD1418 
JD1381; H109E in RPL11B 
JD1419 
JD1381; H109R in RPL11B 
JD1420 
JD1381; H109F in RPL11B 
JD1421 
JD1381; KEYQ_87-90_RRRR in RPL11B 
JD1422 
JD1381; EHI_108-110_RRR in RPL11B 
JD1423 
JD1381; IKY_114-116_RRR in RPL11B 
JD1424 
JD1381; KYD_115-117_RRR in RPL11B 
JD1425 
JD1381; KEYQ_87-90_!!!! in RPL11B 
JD1426 
JD1381; EHI_108-110_!!! in RPL11B 
JD1427 
JD1381; HID_109-111_!!! in RPL11B 
JD1428 
JD1381; IKY_114-116_!!! in RPL11B 
JD1429 
JD1381; E108R in RPL11B 
JD1430 
JD1381; I110R in RPL11B 
JD1431 
JD1381; D111R in RPL11B 
JD1432 
JD1381; KEYQ_ 87-90_AAA in RPL11B 
JD1433 
JD1381; RDRNF_92-96_AAA in RPL11B 
JD1434 
JD1381; EHI_108-110_AA in RPL11B 
JD1435 
JD1381; HID_109-111_AA in RPL11B 
JD1436 
JD1381; IKY_114-116_AA in RPL11B 
JD1437 
JD1381; KYD_115-117_AA in RPL11B 
JD1438 
JD1381; RYTV_51-54_AAA in RPL11B 
JD1439 
JD1381; VRTF_54-57_AAA in RPL11B 
JD1440 
JD1381; K87A in RPL11B 
JD1441 
JD1381; E88A in RPL11B 
JD1442 
JD1381; Y89A in RPL11B 
JD1443 
JD1381; Q90A in RPL11B 
JD1444 
JD1381; DRN_93-95_AA, F96N in RPL11B 
JD1445 
JD1381; R94A, F96N in RPL11B 
JD1446 
JD1381; E108A in RPL11B 
JD1447 
JD1381; I110A in RPL11B 
 
 
154 
Yeast Strain ID 
Description 
JD1448 
JD1381; D111A in RPL11B 
JD1449 
JD1381; R94A in RPL11B 
JD1450 
JD1381; DRN_93-95_AA in RPL11B 
JD1451 
JD1381; R51A in RPL11B 
JD1452 
JD1381; F57A in RPL11B 
JD1453 
JD1381; R61A in RPL11B 
JD1454 
JD1381; V160I in RPL11B 
JD1455 
JD1381; L112W in RPL11B 
JD1456 
JD1381; D93E, F96A in RPL11B 
JD1457 
JD1381; KYD_115-117_!!! in RPL11B 
 
 
 
 
 
155 
 Apendix B: Yeast Plasmid List 
 
Table 6. Plasmids produced. 
Plasmid 
Name 
Backbone 
Plasmid 
Insertion 
Bacterial 
Marker 
Yeast 
Marker 
pJD0810 pRS314 
wild-type L11B with wild-type UTRs in 
pRS314 AmpR Trp1 
pJD1100 pJD0810 L11B mutant Y52! AmpR Trp1 
pJD1101 pJD0810 L11B mutant Y52A AmpR Trp1 
pJD1102 pJD0810 L11B mutant Y52I AmpR Trp1 
pJD1103 pJD0810 L11B mutant Y52S AmpR Trp1 
pJD1104 pJD0810 L11B mutant Y52N AmpR Trp1 
pJD1105 pJD0810 L11B mutant Y52Q AmpR Trp1 
pJD1106 pJD0810 L11B mutant Y52E AmpR Trp1 
pJD1107 pJD0810 L11B mutant Y52R AmpR Trp1 
pJD1108 pJD0810 L11B mutant Y52H AmpR Trp1 
pJD1109 pJD0810 L11B mutant Y52F AmpR Trp1 
pJD1110 pJD0810 L11B mutant R92! AmpR Trp1 
pJD1111 pJD0810 L11B mutant R92A AmpR Trp1 
pJD1112 pJD0810 L11B mutant R92I AmpR Trp1 
pJD1113 pJD0810 L11B mutant R92S AmpR Trp1 
pJD1114 pJD0810 L11B mutant R92N AmpR Trp1 
pJD1115 pJD0810 L11B mutant R92Q AmpR Trp1 
pJD1116 pJD0810 L11B mutant R92E AmpR Trp1 
pJD1117 pJD0810 L11B mutant R92K AmpR Trp1 
pJD1118 pJD0810 L11B mutant R92H AmpR Trp1 
pJD1119 pJD0810 L11B mutant R92F AmpR Trp1 
pJD1120 pJD0810 L11B mutant F96! AmpR Trp1 
pJD1121 pJD0810 L11B mutant F96A AmpR Trp1 
pJD1122 pJD0810 L11B mutant F96I AmpR Trp1 
pJD1123 pJD0810 L11B mutant F96S AmpR Trp1 
pJD1124 pJD0810 L11B mutant F96N AmpR Trp1 
pJD1125 pJD0810 L11B mutant F96Q AmpR Trp1 
pJD1126 pJD0810 L11B mutant F96E AmpR Trp1 
pJD1127 pJD0810 L11B mutant F96R AmpR Trp1 
pJD1128 pJD0810 L11B mutant F96H AmpR Trp1 
pJD1129 pJD0810 L11B mutant F96W AmpR Trp1 
 
 
156 
Plasmid 
Name 
Backbone 
Plasmid 
Insertion 
Bacterial 
Marker 
Yeast 
Marker 
pJD1130 pJD0810 L11B mutant H109! AmpR Trp1 
pJD1131 pJD0810 L11B mutant H109A AmpR Trp1 
pJD1132 pJD0810 L11B mutant H109I AmpR Trp1 
pJD1133 pJD0810 L11B mutant H109S AmpR Trp1 
pJD1134 pJD0810 L11B mutant H109N AmpR Trp1 
pJD1135 pJD0810 L11B mutant H109Q AmpR Trp1 
pJD1136 pJD0810 L11B mutant H109E AmpR Trp1 
pJD1137 pJD0810 L11B mutant H109R AmpR Trp1 
pJD1138 pJD0810 L11B mutant H109F AmpR Trp1 
pJD1139 pJD0810 L11B mutant KEYQ_87-90_RRRR AmpR Trp1 
pJD1140 pJD0810 L11B mutant EHI_108-110_RRR AmpR Trp1 
pJD1141 pJD0810 L11B mutant IKY_114-116_RRR AmpR Trp1 
pJD1142 pJD0810 L11B mutant KYD_115-117_RRR AmpR Trp1 
pJD1143 pJD0810 L11B mutant KEYQ_87-90_! AmpR Trp1 
pJD1144 pJD0810 L11B mutant EHI_108-110_! AmpR Trp1 
pJD1145 pJD0810 L11B mutant HID_109-111_! AmpR Trp1 
pJD1146 pJD0810 L11B mutant IKY_114-116_! AmpR Trp1 
pJD1147 pJD0810 L11B mutant E108R AmpR Trp1 
pJD1148 pJD0810 L11B mutant I110R AmpR Trp1 
pJD1149 pJD0810 L11B mutant D111R AmpR Trp1 
pJD1150 pJD0810 L11B mutant KEYQ_ 87-90_AAA AmpR Trp1 
pJD1151 pJD0810 L11B mutant RDRNF_92-96_AAA AmpR Trp1 
pJD1152 pJD0810 L11B mutant EHI_108-110_AA AmpR Trp1 
pJD1153 pJD0810 L11B mutant HID_109-111_AA AmpR Trp1 
pJD1154 pJD0810 L11B mutant IKY_114-116_AA AmpR Trp1 
pJD1155 pJD0810 L11B mutant KYD_115-117_AA AmpR Trp1 
pJD1156 pJD0810 L11B mutant RYTV_51-54_AAA AmpR Trp1 
pJD1157 pJD0810 L11B mutant VRTF_54-57_AAA AmpR Trp1 
pJD1158 pJD0810 L11B mutant K87A AmpR Trp1 
pJD1159 pJD0810 L11B mutant E88A AmpR Trp1 
pJD1160 pJD0810 L11B mutant Y89A AmpR Trp1 
pJD1161 pJD0810 L11B mutant Q90A AmpR Trp1 
pJD1162 pJD0810 L11B mutant DRN_93-95_AA, F96N AmpR Trp1 
pJD1163 pJD0810 L11B mutant R94A, F96N AmpR Trp1 
pJD1164 pJD0810 L11B mutant E108A AmpR Trp1 
 
 
157 
Plasmid 
Name 
Backbone 
Plasmid 
Insertion 
Bacterial 
Marker 
Yeast 
Marker 
pJD1165 pJD0810 L11B mutant I110A AmpR Trp1 
pJD1166 pJD0810 L11B mutant D111A AmpR Trp1 
pJD1167 pJD0810 L11B mutant R94A AmpR Trp1 
pJD1168 pJD0810 L11B mutant DRN_93-95_AA AmpR Trp1 
pJD1169 pJD0810 L11B mutant R51A AmpR Trp1 
pJD1170 pJD0810 L11B mutant F57A AmpR Trp1 
pJD1171 pJD0810 L11B mutant R61A AmpR Trp1 
pJD1172 pJD0810 L11B mutant V160I AmpR Trp1 
pJD1173 pJD0810 L11B mutant L112W AmpR Trp1 
pJD1174 pJD0810 L11B mutant D93E, F96A AmpR Trp1 
pJD1175 pJD0810 L11B mutant KYD_115-117_! AmpR Trp1 
pJD1176 pJD0810 
lethal L11B mutant: RYTVRTFGIR_51-
60_! AmpR Trp1 
pJD1177 pJD0810 
lethal L11B mutant: RYTVRTFGIR_51-
60_AAAAAA AmpR Trp1 
pJD1178 pJD0810 
lethal L11B mutant: RYTVRTFGIR_51-
60_RRRRRRRRRR AmpR Trp1 
pJD1179 pJD0810 
lethal L11B mutant: FGIR_57-
60_AAA AmpR Trp1 
pJD1180 pJD0810 lethal L11B mutant: 92-96 delta AmpR Trp1 
pJD1181 pJD0810 lethal L11B mutant: 93-96_RRRR AmpR Trp1 
pJD1182 pJD0810 lethal L11B mutant: HID_109-111_RRR AmpR Trp1 
 
 
 
158 
 Apendix C: Oligonucleotide Primer List 
 
Table 7. Oligonucleotides used in site directed mutagenesis. 
JD-
Strain 
Mutation Forward and Reverse 5? to 3? Oligonucleotide Sequences 
GGTCAAACTCAGTTCAATCCAAGCCCGACGACGACGAGAACTT
CGGTATCAGAG 
Lethal 
RYTVRT
FGIR51-
60(Al R) 
CTTCTGATACCGAAGTCTTCGTCGTCGTCGGCTTGGATTGAACTG
GAGTTGACC 
GGTCAAACTCAGTTCAATCCAAGCCGCAGCAGCAGCAGCAGCAGC
AGCAGCAGCAAGAAACGAAAAAATTGCTGTTCACG 
Lethal 
RYTVRT
FGIR51-
60(al A) 
CGTGACAGCAATTTCGTTTCTTGCTGCTGCTGCTGCT 
GCTGCTGCTGCTGCGGCCTGGATTGAACTGGAGTTTGAC 
GGTCAAACTCAGTTCAATCCAAGCCAGAACGAAATTGCTGTT
CACG 
Lethal 
RYTVRT
FGIR51-
60 ! 
CGTGACAGCAATTTCGTTTCTGGCTTGGATTGACTGGAGTTTG
ACC 
GGTCAAACTCAGTTCAATCCAAGCCGCAGCAGCAGCAAGAACTT
CGGTATCAGAG 
1438 
RYTV51-
54AAA 
CTTCTGATACCGAAGTCTTGCTGCTGCTGCGCTTGGATTGAACTG
GAGTTGACC 
CCAGTCAATCCAAGCCAGATACACTGCAGCAGCAGCAGGTATCAG
AAGAAACG 
1439 
VRTF54-
57AAA 
CGTTCTTCTGATACCTGCTGCTGCTGCAGTGTATCTGGCCTTGATG
AACTGG 
CCAGATACACTGTCAGACTGCAGCAGCAGCAAGAAACGAAAAAATT
GCTGTTCACG 
Lethal 
FGIR57-
60AAA 
CGTGACAGCAATTTCGTTTCTTGCTGCTGCTGCAGTTCTGACAGT
GTATCTGG 
CCAGTCAATCCAAGCCAGAACTGTCAGAACTTCGG 
1382 Y52! 
CCGAAGTCTGACAGTCTGGCCTGGATTGAACTGG 
CCAGTCAATCCAAGCCAGAGCAACTGTCAGAACTTCG 
1383 Y52A 
CCGAAGTCTGACAGTGCTCTGGCTTGGATTGACTGG 
CCAGTCAATCCAAGCCAGAATCACTGTCAGAACTTCG 
1384 Y52I 
CCGAAGTCTGACAGTGATTCTGGCTTGGATTGAACTGG 
CCAGTCAATCCAAGCCAGATCACTGTCAGAACTTCG 
1385 Y52S 
CCGAAGTCTGACAGTGATCTGGCTTGGATTGACTGG 
CCAGTCAATCCAAGCCAGAAACACTGTCAGAACTTCG 
1386 Y52N 
CCGAAGTCTGACAGTGTTCTGGCTTGGATTGACTGG 
CCAGTCAATCCAAGCCAGACAAACTGTCAGAACTTCGG 
1387 Y52Q 
CCGAAGTCTGACAGTTGTCTGGCTTGGATTGACTGG 
CCAGTCAATCCAAGCCAGAGAAACTGTCAGAACTTCG 
1388 Y52E 
CCGAAGTCTGACAGTTCTCTGGCTTGGATTGACTGG 
CCAGTCAATCCAAGCCAGACGAACTGTCAGAACTTCG 
1389 Y52R 
CCGAAGTCTGACAGTCGTCTGGCTTGGATTGACTGG 
CCAGTCAATCCAAGCCAGACACACTGTCAGAACTTCG 
1390 Y52H 
CCGAAGTCTGACAGTGTGTCTGGCTTGGATTGACTGG 
CCAGTCAATCCAAGCCAGATTCACTGTCAGAACTTCG 
1391 Y52F 
CCGAAGTCTGACAGTGATCTGGCTTGGATTGACTGG 
CTCCAGTCAATCCAAGCCGCATACACTGTCAGAACTTCG 
1451 R51A 
CGAAGTCTGACAGTGTATGCGGCCTGGATTGAACTGGAG 
 
 
159 
 
JD-
Strain 
Mutation Forward and Reverse 5? to 3? Oligonucleotide Sequences 
GATACACTGTCAGAACTGCAGGTATCAGAAGAAACG 
1452 F57A 
CGTTCTTCTGATACCTGCAGTTCTGACAGTGTATC 
GTCAGAACTTCGGTATCAGAGCAAACGAAAAAATTGCTGTTCAC 
1453 R61A 
GTGAACAGCAATTTTCGTTTGCTCTGATACGAAGTTCTGAC 
GTCAAGGAATACCAATTGCGACGACGACGACGATCTGCTACGTAA
CTTCGGTTCGGT 
Lethal 
RDRNF9
2-
96RRR
R 
ACCGAAACCGAAGTTACCGGTAGCAGATCGTCGTCGTCGTCGCAATG
GTATTCTGAC 
GTCAAGGAATACCAATTGTCTGCTACGGTAACTCGGTTCGGT 
Lethal 
RDRNF9
2-96 ! 
ACCGAAACCGAAGTTACCGGTAGCAGACATTGGTATTCCTTGAC 
GTCAAGGAATACCAATTGGCAGCAGCAGCAGCATCTGCTACCGGTA
CTTCGGTTCGGT 
1433 
RDRNF9
2-
96AAA
A 
ACCGAAACCGAAGTTACCGGTAGCAGATGCTGCTGCTGCTGCCAATTG
GTATTCTGAC 
GTCAAGGAATACCAATTGAGAGCAGCAGCAAACTCTGCTACGTAA
CTTCGGTTCG 
1444 
DRN93-
96AA, 
F96N 
CGAACCGAGTACCGGTAGCAGAGTTTGCTGCTGCTCTCATTGGT
ATTCTGAC 
GGAATACCAATTGAGAGACGCAAACAACTCTGCTACGTAACTTCG
GTTCG 
1445 
R94A, 
F96N 
CGAACCGAGTACCGGTAGCAGAGTTGTTTGCGTCTCTCAATTGGT
ATTC 
GGAATACCAATTGAGAGACGCAAACTTCTCTGCTACGTAACTTCG
TTTCG 
1449 R94A 
CGAACCGAGTACCGGTAGCAGAGAAGTTGCGTCTCTCAATGT
ATTC 
GTCAAGGAATACCAATTGAGAGCAGCAGCATTCTCTGCTACGTAAC
TTCGTTTCG 
1450 
DRN93-
95AA 
CGAACCGAGTACCGGTAGCAGAGAATGCTGCTGCTCTCAATGT
ATTCTGAC 
Random mutant, no primer, made while using F96A Primer set 
1456 
D93E, 
F96A 
Random utant, no primer, made while using F96A Primer set 
GGTTGAAGGTCAAGGAATACCAATGACAGAACTTCTCTGC 
1392 R92! 
GCAGAGAAGTTCTGTCAATTGGTATTCCTTGACTTCAAACC 
GGTCAAGGAATACCAATTGGCAGACAGAACTTCTCTGC 
1393 R92A 
GCAGAGAAGTTCTGTCTGCCAATGTATCCTTGACC 
GGTCAAGGAATACCAATTGATAGACAGAACTTCTCTGC 
1394 R92I 
GCAGAGAAGTTTCTGTCTATCATTGGTATTCCTTGAC 
GGTCAAGGAATACCAATTGAGTGACAGAAACTCTCTGC 
1395 R92S 
GCAGAGAAGTTCTGTCACTCAATGTATCCTTGACC 
GGTCAAGGAATACCAATTGAATGACAGAAACTCTCTGC 
1396 R92N 
GCAGAGAAGTTCTGTCATTCAATGTATCCTTGACC 
GGTCAAGGAATACCAATTGCAAGACAGAAACTCTCTGC 
1397 R92Q 
GCAGAGAAGTTCTGTCTGCAATGTATCCTTGACC 
GGTCAAGGAATACCAATTGGAAGACAGAAACTCTCTGC 
1398 R92E 
GCAGAGAAGTTCTGTCTCCAATGTATCCTTGACC 
Random utant, no primer 
1399 R92K 
Random utant, no primer 
 
 
160 
 
JD-
Strain 
Mutation Forward and Reverse 5? to 3? Oligonucleotide Sequences 
GGTCAAGGAATACCAATTGCATGACAGAAACTCTCTGC 
1400 R92H 
GCAGAGAAGTTCTGTCATGCAATGTATCCTTGACC 
GGTCAAGGAATACCAATTGTTTGACAGAACTTCTCTGC 
1401 R92F 
GCAGAGAAGTTCTGTCAAACAATGTATCCTTGACC 
CCAATGAGAGACAGAACTCTGCTACCGGTAACTCG 
1402 F96! 
CGAGTACCGGTAGCAGAGTTTCTGTCTCTCATTGG 
CCAATGAGAGACAGAACGCCTCTGCTACCGGTACTTC 
1403 F96A 
GAAGTTACCGGTAGCAGAGGCGTTCTGTCTCTCAATG 
CCAATGAGAGACAGAACATCTCTGCTACGTAACTTCG 
1404 F96I 
CGAGTACCGGTAGCAGAGATGTTCTGTCTCTCAATTG 
CCAATGAGAGACAGAACTCCTCTGCTACCGGTACTTCG 
1405 F96S 
CGAGTACCGGTAGCAGAGGAGTTCTGTCTCTCAATTG 
CCAATGAGAGACAGAACAACTCTGCTACCGGTAACTCG 
1406 F96N 
CGAGTACCGGTAGCAGAGTTGTTTCTGTCTCTCATTGG 
CCAATGAGAGACAGAACCAATCTGCTACCGGTAACTCG 
1407 F96Q 
CGAGTACCGGTAGCAGATTGGTTCTGTCTCTCATTGG 
CCAATGAGAGACAGAACGAATCTGCTACCGGTAACTCG 
1408 F96E 
CGAGTACCGGTAGCAGATTCGTTTCTGTCTCTCATTGG 
CCAATGAGAGACAGAACCGCTCTGCTACCGGTAACTCG 
1409 F96R 
CGAGTACCGGTAGCAGAGCGGTTCTGTCTCTCAATG 
CCAATGAGAGACAGAAACCACTCTGCTACCGGTAACTCG 
1410 F96H 
CGAGTACCGGTAGCAGAGTGGTTTCTGTCTCTCATTGG 
CCAATGAGAGACAGAACTGGTCTGCTACCGGTAACTCG 
1411 F96W 
CGAGTACCGGTAGCAGACCAGTTCTGTCTCTCAATG 
TTCGTTTCGTATTGACGACGACGAGACTGGGTATCAAGTATGAC 
1422 
EHI108-
110RR 
GTCATACTGATACCCAAGTCTCGTCGTCGGTCAATACCGAAACCGAA 
TTCGTTTCGTATTGACGAACGACGACGATTGGGTATCAAGTATGAC 
Lethal 
HID109-
111RRR 
GTCATACTGATACCAATCGTCGTCGTTCGTCAATACCGAAACCGAA 
TTCGTTTCGTATTGACGACTTGGTATCAAGTATGAC 
1426 
EHI108-
110 ! 
GTCATACTGATACCAAGTCGTCAATACCGAACCGA 
TTCGTTTCGTATTGACGAATTGGGTATCAAGTATGAC 
1427 
HID109-
111 ! 
GTCATACTGATACCAATTCGTCAATACCGAACCGA 
TTCGTTTCGTATTGACGACACATTGACTGGGTATCAAGTATGAC 
1429 E108R 
GTCATACTGATACCAAGTCAATGTGTCGGTCAATACCGAAACCGAA 
TTCGTTTCGTATTGACGAACACCGAGACTTGGTATCAAGTATGAC 
1430 I110R 
GTCATACTGATACCAAGTCTCGGTGTTCGTCAATACCGAAACCGAA 
TTCGTTTCGTATTGACGAACACATTCGATTGGGTATCAAGTATGAC 
1431 D11R 
GTCATACTGATACCAATCGATGTGTTCGTCAATACCGAAACCGAA 
CGGTTCGGTATGACGCAGCAGCAGACTTGGTATCAAGTATGAC 
1434 
EHI108-
110AA 
GTCATACTGATACCAAGTCTGCTGCTGCGTCAATACCGAAACCG 
TTCGTTTCGTATTGACGAAGCAGCAGCATTGGGTATCAAGTATGAC 
1435 
HID109-
111AA 
GTCATACTGATACCAATGCTGCTGCTTCGTCAATACCGAAACCGAA 
CGGTTCGGTATGACGCACACATTGACTGGGTATCAAGTATGAC 
1446 E108A 
GTCATACTGATACCAAGTCAATGTGTGCGTCAATACCGAAACCG 
CGGTTCGGTATGACGACACGCAGACTGGGTATCAAGTATGAC 
1447 I110A 
GTCATACTGATACCAAGTCTGCGTGTTCGTCAATACCGAAACCG 
CGGTTCGGTATGACGACACATTGCATTGGGTATCAAGTATGAC 
1448 D11A 
GTCATACTGATACCAATGCATGTGTTCGTCAATACCGAAACCG 
 
 
161 
 
JD-
Strain 
Mutation Forward and Reverse 5? to 3? Oligonucleotide Sequences 
Random utant, no primer 
1455 L112W 
Random utant, no primer 
CGGTTCGGTATGACGAATTGACTTGGTATCAGTATGACC 
1412 H109! 
GGTCATACTGATACCAAGTCATTTCGTCATACGAACCG 
CGGTTCGGTATGACGAGCAATGACTTGGTATCAAGTATGAC 
1413 H109A 
GTCATACTGATACCAAGTCAATTGCTCGTCAATACCGAAACCG 
CGGTTCGGTATGACGAATCATTGACTTGGTATCAAGTATGACC 
1414 H109I 
GGTCATACTGATACCAAGTCATGATTTCGTCATACGAAACCG 
CGGTTCGGTATGACGATCCATGACTTGGTATCAAGTATGAC 
1415 H109S 
GGTCATACTGATACCAAGTCATGGATTCGTCATACGAAACCG 
CGGTTCGGTATGACGAAACATTGACTGGGTATCAAGTATGAC 
1416 H109N 
GGTCATACTGATACCAAGTCAATGTTTCGTCAATACCGAACCG 
CGGTTCGGTATGACGACAAATTGACTGGGTATCAAGTATGAC 
1417 H109Q 
GGTCATACTGATACCAAGTCATTTGTTCGTCATACGAAACCG 
CGGTTCGGTATGACGAGAAATTGACTGGGTATCAAGTATGAC 
1418 H109E 
GGTCATACTGATACCAAGTCATTTCTTCGTCATACGAAACCG 
TTCGTTTCGTATTGACGAACGAATTGACTGGGTATCAAGTATGAC 
1419 H109R 
GTCATACTGATACCAAGTCAATTCGTTCGTCAATACCGAAACCGAA 
CGGTTCGGTATGACGATTCATTGACTTGGTATCAGTATGAC 
1420 H109F 
GGTCATACTGATACCAAGTCATGATTCGTCATACGAAACCG 
GAAAGAGGTTGAAGGTCGCAGCAGCAGCATTGAGAGACAGAAACT
CTCTGCTACCGGTACTTC 
1432 
KEYQ 
87-
90AAA 
GAAGTTACCGGTAGCAGAGAAGTTCTGTCTCTCAATGCTGCTGCTGC
GACCTCAAACCTCTTC 
GAAAGAGGTTGAAGGTCGACGACGACGATTGAGAGACAGAAACT
CTCTGCTACCGGTACTTC 
1421 
KEYQ 
87-
90RRR 
GAAGTTACCGGTAGCAGAGAAGTTCTGTCTCTCAATCGTCGTCGTCG
GACCTCAAACCTCTTC 
GAAAGAGGTTGAAGGTCTGAGAGACAGAAACTCTCTGCTACCGGT
AACTC 
1425 
KEYQ87-
90 ! 
GAAGTTACCGGTAGCAGAGAAGTTCTGTCTCTCAAGACCTTCAAC
TCTTTC 
GAAAGAGGTTGAAGGTCGCAGAATACCAATTGAGAGACAGAAACT
CTCTGCTACCGG 
1440 K87A 
CCGGTAGCAGAGAGTTCTGTCTCTCAATTGGTATTCTGCGACCTCA
AACCTCTTC 
GAGGTTGAAGGTCAAGGCATACATTGAGAGACAGAACTTCTCT
GCTACCGG 
1441 E88A 
CCGGTAGCAGAGAGTTCTGTCTCTCAATTGGTATGCCTTGACTTCA
AACCTC 
GAGGTTGAAGGTCAAGGAAGCACAATTGAGAGACAGAAACTTCTCT
GCTACCGGTAAC 
1442 Y89A 
GTTACCGGTAGCAGAGAAGTTTCTGTCTCTCAATTGTGCTCTTGAC
TTCAACTC 
GGTTGAAGGTCAAGGAATACGCATGAGAGACAGAACTTCTCTGCT
ACCGGTAAC 
1443 Q90A 
GTTACCGGTAGCAGAGAAGTTTCTGTCTCTCATGCGTATTCCTTGAC
TTCAAC 
 
 
162 
 
 
 
 
 
 
JD-
Strain 
Mutation Forward and Reverse 5? to 3? Oligonucleotide Sequences 
CACATGACTTGGTGCAGCAGCAGACCATCATCGGT 
1436 
IKY14-
116AA 
ACCGATGGATGGGTCTGCTGCTGCACCCAAGTCAATGTG 
CACATGACTTGGTATCGCAGCAGCACCATCATCGGTATTTTCGT 
1437 
KYD115-
117AA 
ACCGAAAATACCGATGGATGGTGCTGCTGCGATACCAAGTCATGTG 
CACATGACTTGGTCGACGACGAGACCATCATCGGT 
1423 
IKY14-
116RR 
ACCGATGGATGGGTCTCGTCGTCGACCAAGTCAATGTG 
CACATGACTTGGTATCCGACGACGACCATCATCGGTATTTTCGT 
1424 
KYD115-
117RR 
ACCGAAAATACCGATGGATGGTCGTCGTCGGATACCAAGTCATGTG 
CACATGACTTGGTGACCCATCATCGGT 
1428 
IKY14-
116 ! 
ACCGATGGATGGGTCACCAAGTCAATGTG 
CACATGACTTGGTATCCCATCATCGGTATTTCGGT 
1457 
KYD115-
117 ! 
ACCGAAAATACCGATGGATGGGATACCAAGTCAATGTG 
Random utant, no primer 
1454 V160I 
Random utant, no primer 
 
 
163 
 
 
!6D6H6<86B)
)
;0!324BL-2'!@R!g242+!XR!^M&M,%6(!WR!^M&M,%6!*!h1?;?i!S+/&:()!&:+MA:M+2!%F!:-2!
2MP(+/%:#A!+#$%&%'20!LA#24A2!G?c!;1?GB;1?80!
10!E)(4:(!"gR!*(.2+!OU!h;8Ii!9-2!)#&:!%F!A/:%,)(&'#A!+#$%&%'()!,+%:2#4&!%F!
L(A-(+%'/A2&!A2+26#&#(20!^2(&:!;Hc!HQ;BHQQ0!
G0!@.#+2V($()(!]R!J+(4P!g!h1?8i!>)%4.(:#%4!#4!:+(4&)(:#%4!(&!(!D/4('#A!
#4:2+(A:#%4!('%4.!:-2!+#$%&%'2R!:"C@R!(4D!2)%4.(:#%4!F(A:%+&!>JBW!(4D!
>JB9M0!bM(+:2+)/!"26#27&!%F!3#%,-/&#A&!H1c!;<8B1??0!
H0!a()2!*R!_(6#()%6!@R!X#!OR!L:(.!L*R!L24.M,:(!gR!2:!()0!h1??Gi!=4A%+,%+(:#%4!%F!
('#4%(A/)B:"C@!#4:%!:-2!+#$%&%'2!(&!&24!$/!A+/%B2)2A:+%4!'#A+%&A%,/0!
C(:M+2!L:+MA:M+()!j!*%)2AM)(+!3#%)%./!;?c!I88B8?N0!
<0!L,(-4!S*R!W%'2VBX%+24V%!*WR!W+(&MA#!"@R!g%+.24&24!"R!@4D2+&24!W"R!2:!()0!
h1?Hi!Z%'(#4!'%62'24:&!%F!2)%4.(:#%4!F(A:%+!2>J1!(4D!:-2!2MP(+/%:#A!
I?L!+#$%&%'2!F(A#)#:(:2!:"C@!:+(4&)%A(:#%40!>*35!g%M+4()!1Gc!;?IB;?;80!
N0!J+(4P!gR!@.+(7()!"`!h1??i!@!+(:A-2:B)#P2!#4:2+B&M$M4#:!+2%+.(4#V(:#%4!%F!:-2!
+#$%&%'2!DM+#4.!:+(4&)%A(:#%40!C(:M+2!H?Nc!G;IBG110!
Q0!a()2!*R!_(6#()%6!@R!L24.M,:(!gR!"(7(:!\R!>-+24$2+.!*R!2:!()0!h1?Gi!X%AP#4.!
(4D!M4)%AP#4.!%F!+#$%&%'()!'%:#%4&0!S2)!;Hc!;1GB;GH0!
I0!J+(4P!gR!W(%!UR!L24.M,:(!gR!W(%!CR!9(/)%+!Zg!h1?Qi!9-2!,+%A2&!%F!'"C@B:"C@!
:+(4&)%A(:#%40!E+%A2D#4.&!%F!:-2!C(:#%4()!@A(D2'/!%F!LA#24A2&!%F!:-2!
\4#:2D!L:(:2&!%F!@'2+#A(!;?Hc!;8NQ;B;8NQI0!
80!L,(-4!S*R!32AP'(4!"R!>&7(+!CR!E24AV2P!E@R!L()#!@R!2:!()0!h1?;i!L:+MA:M+2!%F!
:-2!I?L!+#$%&%'2!F+%'!L(A-(+%'/A2&!A2+26#&#(2BB:"C@B!+#$%&%'2!(4D!
&M$M4#:B&M$M4#:!#4:2+(A:#%4&0!S2))!;?Qc!GQGBGIN0!
;?0!S%+4#&-!EaR!>+'%)24P%!ZCR!C%)2+!UJR!U(!9!h1?Ii!L,%4:(42%M&!#4:2+&M$M4#:!
+%:(:#%4!#4!&#4.)2!+#$%&%'2&0!*%)2AM)(+!S2)!G?c!<QIB<II0!
;0!X#!OR!@.#+2V($()(!]R!X2#!gR!3%M(P(V!XR!3+M42)2!gXR!2:!()0!h1?Ii!"2A%.4#:#%4!%F!
('#4%(A/)B:"C@c!(!A%''%4!'%)2AM)(+!'2A-(4#&'!+262()2D!$/!A+/%B>*0!
>*35!g%M+4()!1Qc!GG1BGGG;0!
;10!9(/)%+!ZgR!Z26P%:(!3R!UM(4.!@ZR!9%,F!*R!C(+(/(4(4!>R!2:!()0!h1?8i!
S%',+2-24&#62!'%)2AM)(+!&:+MA:M+2!%F!:-2!2MP(+/%:#A!+#$%&%'20!
L:+MA:M+2!;Qc!;<8;B;N?H0!
;G0!J#&A-2+!CR!`%4262.(!@XR!O#4:2+'2/2+!OR!"%D4#4(!*aR!L:(+P!U!h1?;?i!
"#$%&%'2!D/4('#A&!(4D!:"C@!'%62'24:!$/!:#'2B+2&%)62D!2)2A:+%4!
A+/%'#A+%&A%,/0!C(:M+2!HNc!G18BGGG0!
;H0!W($(&-6#)#!=LR!@.+(7()!"`R!L,(-4!S*R!W+(&MA#!"@R!L62+.M4!Z=R!2:!()0!h1??i!
L%)M:#%4!&:+MA:M+2!%F!:-2!>0!A%)#!Q?L!+#$%&%'2!(:!;0<!@!+2&%)M:#%40!S2)!
;??c!<GQB<H80!
;<0!LA-M7#+:-!3LR!3%+%6#4&P(/(!*@R!U(M!SOR!_-(4.!OR!a#)(BL(4[M+[%!@R!2:!()0!
h1?<i!L:+MA:M+2&!%F!:-2!$(A:2+#()!+#$%&%'2!(:!G0<!k!+2&%)M:#%40!LA#24A2!
G;?c!I1QBIGH0!
 
 
164 
;N0!^M&M,%6(!WR!g2442+!XR!"22&!3R!*%+(&!ZR!^M&M,%6!*!h1?Ni!L:+MA:M+()!$(&#&!
F%+!'2&24.2+!"C@!'%62'24:!%4!:-2!+#$%&%'20!C(:M+2!HHc!G8;BG8H0!
;Q0!_-(4.!OR!ZM4P)2!g@R!S(:2!gU!h1?8i!L:+MA:M+2&!%F!:-2!+#$%&%'2!#4!
#4:2+'2D#(:2!&:(:2&!%F!+(:A-2:#4.0!LA#24A2!G1<c!;?;HB;?;Q0!
;I0!C#&&24!ER!U(4&24!gR!3(4!CR!*%+2!E3R!L:2#:V!9@!h1??i!9-2!&:+MA:M+()!$(&#&!%F!
+#$%&%'2!(A:#6#:/!#4!,2,:#D2!$%4D!&/4:-2&#&0!LA#24A2!1I8c!81?B8G?0!
;80!U(+'&!gR!LA-)M24V24!JR!_(+#6(A-!"R!3(&-(4!@R!W(:!LR!2:!()0!h1?;i!U#.-!
+2&%)M:#%4!&:+MA:M+2!%F!:-2!)(+.2!+#$%&%'()!&M$M4#:!F+%'!(!'2&%,-#)#A!
2M$(A:2+#M'0!S2)!;?Qc!NQ8BNII0!
1?0!_#6!WR!U(+(4!WR!9-#+M'()(#!Z!h1?<i!"#$%&%'2!2Y#:!:M42)!A(4!24:+%,#A()/!
&:($#)#V2!(),-(B-2)#A2&0!E+%A2D#4.&!%F!:-2!C(:#%4()!@A(D2'/!%F!LA#24A2&!
%F!:-2!\4#:2D!L:(:2&!%F!@'2+#A(!;?1c!;I8<NB;I8N;0!
1;0!O%)-2(D!S@R!*AS%+'#AP!EgR!g%-4&%4!@>!h1?Hi!C(&A24:!'2'$+(42!(4D!
&2A+2:%+/!,+%:2#4&!D#FF2+!#4!J">9BD2:2A:2D!F%)D#4.!F(+!#4&#D2!:-2!+#$%&%'2!
(4D!#4!:-2#+!2Y,%&M+2!:%!+#$%&%'()!,+%:2#4&0!S2)!;Nc!Q1<BQGN0!
10!a%&!C"R!W2+&:2#4!*R!L:2#:V!9@R!*%+2!E3!h1?Ni!9-2!.2%'2:+/!%F!:-2!
+#$%&%'()!,%)/,2,:#D2!2Y#:!:M42)0!g%M+4()!%F!*%)2AM)(+!3#%)%./!GN?c!I8GB
8?N0!
1G0!*2)2&2!9R!]M2!_!h;8<i!9-2!4MA)2%)M&c!(4!%+.(42)2!F%+'2D!$/!:-2!(A:!%F!
$M#)D#4.!(!+#$%&%'20!SM+24:!5,#4#%4!#4!S2)!3#%)%./!Qc!G;8BG1H0!
1H0!LA-22+!\R!U%AP!"!h;88i!L:+MA:M+2!(4D!FM4A:#%4!%F!:-2!4MA)2%)M&0!SM++24:!
5,#4#%4!#4!S2))!3#%)%./!;;c!GI<BG8?0!
1<0!`+2&&)2+!ZR!"%[%!*R!X#4D2+!ER!D2!X(!S+MV!g!h;888i!L,$;,!#&!(!,M:(:#62!
'2:-/):+(4&F2+(&2!+2lM#+2D!F%+!N?L!+#$%&%'()!&M$M4#:!$#%.242&#&!#4!
L(A-(+%'/A2&!A2+26#&#(20!CMA)2#A!@A#D&!"2&2(+A-!1Qc!H<8IBHN?I0!
1N0!Z#4'(4!gZ!h1?8i!9-2!2MP(+/%:#A!+#$%&%'2c!AM+24:!&:(:M&!(4D!A-()24.2&0!g!
3#%)!S-2'!1IHc!;QN;B;;QN<0!
1Q0!U24+(&!@`R!L%MD2:!gR!W2+M&!*R!X2$(+%4!LR!S(#V2+.M2&BJ2++2+!*R!2:!()0!h1??Ii!
9-2!,%&:B:+(4&A+#,:#%4()!&:2,&!%F!2MP(+/%:#A!+#$%&%'2!$#%.242&#&0!S2)M)(+!
(4D!*%)2AM)(+!X#F2!LA#24A2&!N<c!1GHB1G<80!
1I0!*(D24!3>R!UM.-2&!g*!h;8Qi!>MP(+/%:#A!+#$%&%'()!"C@c!:-2!+2A24:!
2YA#:2'24:!#4!:-2!4MA)2%:#D2!'%D#F#A(:#%4!,+%$)2'0!S-+%'%&%'(!;?<c!
G8;BH??0!
180!`)%%:7#[P!gR!E)(4:(!"g!h;8QGi!@4()/&#&!%F!:-2!'2:-/)(:#%4!&#:2&!#4!/2(&:!
+#$%&%'()!"C@0!>M+%,2(4!g%M+4()!%F!3#%A-2'#&:+/!G8c!G1<BGGG0!
G?0!W+(42'(4!LR!3(&2+.(!Lg!h1?Hi!"#$%&%'2!$#%.242&#&c!%F!P4%$&!(4D!"C@!
,+%A2&#4.0!>Y,2+#'24:()!S2)!"2&2(+A-!18Nc!HGB<?0!
G;0!`+2&&)2+!ZR!X#4D2+!ER!D2!X(!S+MV!g!h;888i!E+%:2#4!:+(4&B(A:#4.!F(A:%+&!
#46%)62D!#4!+#$%&%'2!$#%.242&#&!#4!L(A-(+%'/A2&!A2+26#&#(20!*%)2AM)(+!
j!S2))M)(+!3#%)%./!;8c!QI8QBQ8;10!
G10!`+2&)2+!ZR!UM+:!>R!3(&)2+!g!h1?;?i!Z+#6#4.!+#$%&%'2!(&2'$)/0!3#%A-#'#A(!
2:!3#%,-/&#A(!@A:(!;I?Gc!NQGBNIG0!
G0!O(+42+!g"!h;88i!9-2!2A%4%'#A&!%F!+#$%&%'2!$#%&/4:-2&#&!#4!/2(&:0!9+24D&!
#4!3#%A-2'#A()!LA#24A2&!1Hc!HGQBHH?0!
GH0!3%M(D)%M4!JR!Z%442+!ZR!`M+)(4D!SW!h;8IGi!S%D%4B&,2A#F#A!'#&24&2!2+%+&!
#4!6#6%0!>*35!g%M+4()!1c!;G<;B;G<N0!
 
 
165 
G<0!X(M.-+2(!*!h;8I;i!L,22DB(AAM+(A/!+2)(:#%4&-#,&!DM+#4.!#4!6#:+%!(4D!#4!6#6%!
,+%:2#4!$#%&/4:-2&#&0!3#%A-#'#2!NGc!;H<B;NI0!
GN0!E#&(+26!@aR!LP($P#4!*@R!E#&(+26(!aER!LP($P#4(!5aR!"(P%:%4D+(F(+(!@*R!2:!()0!
h1?;?i!9-2!+%)2!%F!@3S>;!#4!2MP(+/%:#A!,%&:2+'#4(:#%4!+#$%&%'()!
+2A/A)#4.0!*%)2AM)(+!S2))!GQc!;8NB1;?0!
GQ0!g(AP&%4!"gR!U2)24!S\R!E2&:%6(!9a!h1?;?i!9-2!'2A-(4#&'!%F!2MP(+/%:#A!
:+(4&)(:#%4!#4#:#(:#%4!(4D!,+#4A#,)2&!%F!#:&!+2.M)(:#%40!C(:M+2!"26#27&!
*%)2AM)(+!S2))!3#%)%./!;;c!;;GB;1Q0!
GI0!^M!^R!*(+#4:A-26!@R!`%)M,(26(!aWR!\4$2-(M4!@R!a2+/(&%6(!9R!2:!()0!h1?8i!
E%&#:#%4!%F!2MP(+/%:#A!:+(4&)(:#%4!#4#:#(:#%4!F(A:%+!2=J;@!%4!:-2!H?L!
+#$%&%'()!&M$M4#:!'(,2D!$/!D#+2A:2D!-/D+%Y/)!+(D#A()!,+%$#4.0!CMA)2#A!
@A#D&!"2&2(+A-!GQc!<;NQB<;I10!
G80!W+#F%!g@R!9(-(+(!L*R!*%+.(4!*@R!L-(:P#4!@gR!*2+#AP!OS!h;8IGi!C27!
#4#:#(:#%4!F(A:%+!(A:#6#:/!+2lM#+2D!F%+!.)%$#4!'"C@!:+(4&)(:#%40!g%M+4()!%F!
3#%)%.#A()!S-2'#&:+/!1<Ic!<I?HB<I;?0!
H?0!W+#F%!g@R!9(-(+(!L*R!X2#&!gER!*%+.(4!*@R!L-(:P#4!@gR!2:!()0!h;8I1i!
S-(+(A:2+#V(:#%4!%F!2MP(+/%:#A!#4#:#(:#%4!F(A:%+!H@R!(!,+%:2#4!#46%)62D!#4!
@9EBD2,24D24:!$#4D#4.!%F!.)%$#4!'"C@0!g%M+4()!%F!3#%)%.#A()!S-2'#&:+/!
1<Qc!<1HNB<1<10!
H;0!9(-(+(!L*R!*%+.(4!*@R!L-(:P#4!@g!h;8IGi!3#4D#4.!%F!#4%&#42B&M$&:#:M:2D!
'"C@!:%!+2:#AM)%A/:2!+#$%&%'2&!(4D!2MP(+/%:#A!#4#:#(:#%4!F(A:%+&!H@!(4D!
H3!+2lM#+2&!@9E0!g%M+4()!%F!3#%)%.#A()!S-2'#&:+/!1<Ic!;G<?B;;G<G0!
H10!S+(#.!@OR!U(.-#.-(:!@R!^M!@9R!L%424$2+.!C!h;8Ii!=4:2+(A:#%4!%F!
,%)/(D24/)(:2B$#4D#4.!,+%:2#4!7#:-!:-2!2=JHW!-%'%)%.M2!E@=E!24-(4A2&!
:+(4&)(:#%40!C(:M+2!G81c!<1?B<1G0!
HG0!X2!UR!9(4.M(/!"XR!3()(&:(!*XR!O2#!SR!3+%74#4.!`LR!2:!()0!h;88Qi!9+(4&)(:#%4!
#4#:#(:#%4!F(A:%+&!2=JB#&%HW!(4D!2=JBH3!#4:2+(A:!7#:-!:-2!,%)/h@iB$#4D#4.!
,+%:2#4!(4D!#4A+2(&2!#:&!"C@!$#4D#4.!(A:#6#:/0!g%M+4()!%F!3#%)%.#A()!
S-2'#&:+/!1Q1c!;N1HQB;N1<<0!
HH0!E(&'%+2!X@R!LA-'2#4.!9*R!*(.!ZR!@,,)2F#2)D!ZgR!@AP2+!*WR!2:!()0!h1?Qi!
9-2!2MP(+/%:#A!:+(4&)(:#%4!#4#:#(:#%4!F(A:%+&!2=J;!(4D!2=J;@!#4DMA2!(4!
%,24!A%4F%+'(:#%4!%F!:-2!H?L!+#$%&%'20!*%)!S2)!1Nc!H;B<?0!
H<0!E#&(+26!@aR!`%)M,(26(!aWR!^M&M,%6!*R!U2)24!S\R!E2&:%6(!9a!h1?Ii!
"#$%&%'()!,%&#:#%4!(4D!A%4:(A:&!%F!'"C@!#4!2MP(+/%:#A!:+(4&)(:#%4!
#4#:#(:#%4!A%',)2Y2&0!>*35!g%M+4()!1Qc!;N?8B;N1;0!
HN0!X%'(P#4!=3R!`%)M,(26(!aWR!*(+#4:A-26!@R!O(.42+!WR!E2&:%6(!9a!h1?Gi!
E%&#:#%4!%F!2MP(+/%:#A!#4#:#(:#%4!F(A:%+!2=J;!%4!:-2!H?L!+#$%&%'()!&M$M4#:!
D2:2+'#42D!$/!D#+2A:2D!-/D+%Y/)!+(D#A()!,+%$#4.0!W242&!Z26!;Qc!1QINB
1Q8Q0!
HQ0!L#'%42:#!@R!*(+V#!LR!*/(&4#P%6!@WR!J($+2:#!@R!^M&M,%6!*R!2:!()0!h1?Ii!
L:+MA:M+2!%F!:-2!G?L!:+(4&)(:#%4!#4#:#(:#%4!A%',)2Y0!C(:M+2!H<c!H;NBH1?0!
HI0!@))24!WLR!_(6#()%6!@R!WM+&P/!"R!>-+24$2+.!*R!J+(4P!g!h1?<i!9-2!A+/%B>*!
&:+MA:M+2!%F!(!:+(4&)(:#%4!#4#:#(:#%4!A%',)2Y!F+%'!>&A-2+#A-#(!A%)#0!S2)!
;1;c!Q?GBQ;10!
 
 
166 
H80!E2&:%6(!9aR!3%+MP-%6!L=R!U2)24!S\!h;8Ii!>MP(+/%:#A!+#$%&%'2&!+2lM#+2!
#4#:#(:#%4!F(A:%+&!;!(4D!;@!:%!)%A(:2!#4#:#(:#%4!A%D%4&0!C(:M+2!G8Hc!I<HB
I<80!
<?0!`%V(P!*!h;8I?i!"%)2!%F!@9E!#4!$#4D#4.!(4D!'#.+(:#%4!%F!H?L!+#$%&%'()!
&M$M4#:&0!S2))!11c!H<8BHNQ0!
<;0!\4$2-(M4!@R!3%+MP-%6!L=R!U2)24!S\R!E2&:%6(!9a!h1?Hi!"2)2(&2!%F!#4#:#(:#%4!
F(A:%+&!F+%'!HIL!A%',)2Y2&!DM+#4.!+#$%&%'()!&M$M4#:![%#4#4.!(4D!:-2!)#4P!
$2:724!2&:($)#&-'24:!%F!A%D%4B(4:#A%D%4!$(&2B,(#+#4.!(4D!-/D+%)/&#&!
%F!2=J1B$%M4D!W9E0!W242&!j!Z262)%,'24:!;Ic!G?QIBG?8G0!
<10!E#&(+26!@aR!`%)M,(26(!aWR!E#&(+26(!aER!*2+#AP!OSR!U2)24!S\R!2:!()0!h1?Ni!
L,2A#F#A!FM4A:#%4()!#4:2+(A:#%4&!%F!4MA)2%:#D2&!(:!P2/!BG!(4D!KH!,%&#:#%4&!
F)(4P#4.!:-2!#4#:#(:#%4!A%D%4!7#:-!A%',%424:&!%F!:-2!'(''()#(4!HIL!
:+(4&)(:#%4!#4#:#(:#%4!A%',)2Y0!W242&!j!Z262)%,'24:!1?c!N1HBNGN0!
<G0!E2&:%6(!9aR!X%'(P#4!=3R!X2!gUR!S-%#!L`R!Z262+!9>R!2:!()0!h1???i!9-2![%#4#4.!
%F!+#$%&%'()!&M$M4#:&!#4!2MP(+/%:2&!+2lM#+2&!2=J<30!C(:M+2!H?Gc!G1BGG<0!
<H0!@AP2+!*WR!L-#4!3LR!Z262+!9>R!X%+&A-!g"!h1?Ni!=4:2+(A:#%4!$2:724!
2MP(+/%:#A!#4#:#(:#%4!F(A:%+&!;@!(4D!<3!#&!+2lM#+2D!F%+!2F#A#24:!+#$%&%'()!
&M$M4#:![%#4#4.0!9-2!g%M+4()!%F!3#%)%.#A()!S-2'#&:+/!1I;c!IHN8BIHQ<0!
<0!E#&(+26!@aR!L-#+%P#P-!C>R!U2)24!S\!h1?<i!9+(4&)(:#%4!#4#:#(:#%4!$/!F(A:%+B
#4D2,24D24:!$#4D#4.!%F!2MP(+/%:#A!+#$%&%'2&!:%!#4:2+4()!+#$%&%'()!24:+/!
&#:2&0!S%',:2&!"24DM&!3#%)%.#2&!G1Ic!<I8BN?<0!
<N0!U2))24!S\!h1??8i!=">LB#4DMA2D!A%4F%+'(:#%4()!A-(4.2&!#4!:-2!+#$%&%'2!(4D!
:-2!'2A-(4#&'!%F!:+(4&)(:#%4!#4#:#(:#%4!$/!#4:2+4()!+#$%&%'()!24:+/0!
3#%A-#'#A(!2:!3#%,-/&#A(!@A:(!;QI8c!<IB<Q?0!
<Q0!E2&:%6(!9aR!X%'(P#4!=3R!U2)24!S\!h1?Hi!E%&#:#%4!%F!:-2!S+Ea!=">L!%4!:-2!
H?L!&M$M4#:!(4D!F(A:%+!D2,24D24A2!%F!=">LTI?L!+#$%&%'2!(&2'$)/0!
>'$%!"2,%+:&!<c!8?NB8;G0!
<I0!"%D4#4(!*aR!J+#AP2!"R!O#4:2+'2/2+!O!h;8Hi!9+(4&#24:!A%4F%+'(:#%4()!
&:(:2&!%F!('#4%(A/)B:"C@!DM+#4.!+#$%&%'2!$#4D#4.!A(:()/V2D!$/!
2)%4.(:#%4!F(A:%+!9M0!3#%A-2'#&:+/!Gc!;1NQB;11Q<0!
<80!5.)2!g*R!3+%D2+&24!Z>R!S)2'%4&!O*R!g+0R!9(+/!*gR!S(+:2+!@ER!2:!()0!h1?;i!
"2A%.4#:#%4!%F!A%.4(:2!:+(4&F2+!"C@!$/!:-2!G?L!+#$%&%'()!&M$M4#:0!
LA#24A2!181c!I8QB8?10!
N?0!5.)2!g*R!"('(P+#&-4(4!a!h1?<i!L:+MA:M+()!=4&#.-:&!#4:%!9+(4&)(:#%4()!
J#D2)#:/0!@44M()!"26#27!%F!3#%A-2'#&:+/!QHc!;18B;QQ0!
N;0!L-(+'(!ZR!SMP+(&!@"R!"%.2+&!>gR!L%M:-7%+:-!Z"R!W+24!"!h1?Qi!*M:(:#%4()!
(4()/&#&!%F!L;1!,+%:2#4!(4D!#',)#A(:#%4&!F%+!:-2!(AM+(A/!%F!D2A%D#4.!$/!
:-2!+#$%&%'20!g%M+4()!%F!*%)2AM)(+!3#%)%./!GQHc!;?N<B;?QN0!
N10!"%D4#4(!*aR!W+%'(D&P#!`3R!`%:-2!\R!O#2D24!Ug!h1?<i!"2A%.4#:#%4!(4D!
&2)2A:#%4!%F!:"C@!#4!:+(4&)(:#%40!J>3L!X2:2+&!<Q8c!8GIB8H10!
NG0!"%D4#4(!*aR!O#4:2+'2/2+!O!h1?;i!J#D2)#:/!%F!('#4%(A/)B:"C@!&2)2A:#%4!%4!
:-2!+#$%&%'2c!P#42:#A!(4D!&:+MA:M+()!'2A-(4#&'&0!@44M()!"26#27!%F!
3#%A-2'#&:+/!Q?c!H;<BHG<0!
NH0!3(4!CR!C#&24!ER!U(4&24!gR!*%+2!E3R!L:2#:V!9@!h1??i!9-2!A%',)2:2!(:%'#A!
&:+MA:M+2!%F!:-2!)(+.2!+#$%&%'()!&M$M4#:!(:!10H!@!+2&%)M:#%40!LA#24A2!1I8c!
8?<B81?0!
 
 
167 
N<0!^M&M,%6!*R!^M&M,%6(!W_R!3(MA%'!@R!X#2$2+'(4!`R!>(+42&:!9CR!2:!()0!
h1?;i!S+/&:()!L:+MA:M+2!%F!:-2!"#$%&%'2!(:!<0!k!"2&%)M:#%40!LA#24A2!
181c!IIGBI8N0!
N0!L:2#:V!9@R!*%+2!E3!h1?Gi!"C@R!:-2!F#+&:!'(A+%'%)2AM)(+!A(:()/&:c!:-2!
+#$%&%'2!#&!(!+#$%V/'20!9+24D&!#4!3#%A-2'#A()!LA#24A2&!1Ic!H;BH;I0!
NQ0!C%)2+!UJR!U%F(+:-!aR!_#'4#(P!X!h;81i!\4M&M()!+2&#&:(4A2!%F!,2,:#D/)!
:+(4&F2+(&2!:%!,+%:2#4!2Y:+(A:#%4!,+%A2DM+2&0!LA#24A2!1<Nc!;H;NB;H;80!
NI0!E(,2!9R!O#4:2+'2/2+!OR!"%D4#4(!*a!h;8Ii!S%',)2:2!P#42:#A!'2A-(4#&'!%F!
2)%4.(:#%4!F(A:%+!9MBD2,24D24:!$#4D#4.!%F!('#4%(A/)B:"C@!:%!:-2!@!&#:2!
%F!:-2!>0!A%)#!+#$%&%'20!>*35!g%M+4()!;Qc!QH8?BQH8Q0!
N80!LA-'2#4.!9*R!UM(4.!`LR!L:+%$2)!L@R!L:2#:V!9@!h1?<i!@4!#4DMA2DBF#:!
'2A-(4#&'!:%!,+%'%:2!,2,:#D2!$%4D!F%+'(:#%4!(4D!2YA)MD2!-/D+%)/&#&!%F!
,2,:#D/)B:"C@0!C(:M+2!HGIc!<1?B<1H0!
Q?0!@.#+2V($()(!]R!X2#!gR!3+M42)2!gXR!5+:#VB*2%V!"JR!W+24!"R!2:!()0!h1?Ii!
a#&M()#V(:#%4!%F!:-2!-/$+#D!&:(:2!%F!:"C@!$#4D#4.!,+%'%:2D!$/!
&,%4:(42%M&!+(:A-2:#4.!%F!:-2!+#$%&%'20!*%)2AM)(+!S2)!G1c!;8?B;8Q0!
Q;0!g2442+!X3R!Z2'2&-P#4(!CR!^M&M,%6(!WR!^M&M,%6!*!L:+MA:M+()!(&,2A:&!%F!
'2&24.2+!"C@!+2(D#4.!F+('2!'(#4:24(4A2!$/!:-2!+#$%&%'20!C(:!L:+MA:!
*%)!3#%)!;Qc!<<B<N?0!
Q10!L2'24P%6!^R!L-(,P#4(!9R!*(P-4%!aR!`#+#)%6!L!h;81i!EM+%'/A#4!+2(A:#%4!F%+!
:-2!@!&#:2B$%M4D!,2,:#D/)B:"C@0!J>3L!X2::2+&!18Nc!1?QB1;?0!
QG0!L-(+'(!ZR!L%M:-7%+:-!Z"R!W+24!"!h1?Hi!>JBWB#4D2,24D24:!+2(A:#6#:/!%F!(!
,+2B:+(4&)%A(:#%4B&:(:2!+#$%&%'2!A%',)2Y!7#:-!:-2!('#4%(A/)!:"C@!
&M$&:+(:2!,M+%'/A#4!&M,%+:&!(4!#4:2+'2D#(:2!h-/$+#Di!&:(:2!%F!:"C@!
$#4D#4.0!"C@!;?c!;?1B;;G0!
QH0!*M4+%!g3R!@):'(4!"3R!5mS%4%+!CR!3)(4A-(+D!LS!h1?Qi!=D24:#F#A(:#%4!%F!:7%!
D#&:#4A:!-/$+#D!&:(:2!#4:2+'2D#(:2&!%4!:-2!+#$%&%'20!*%)2AM)(+!S2)!1<c!
<?<B<;Q0!
Q<0!W(6+#)%6(!XER!L,#+#4!@L!h;8Q;i!L:#'M)(:#%4!%F!n4%4B24V/'#An!:+(4&)%A(:#%4!#4!
+#$%&%'2&!$/!,BA-)%+%'2+AM+#$24V%(:20!J>3L!X2:2+&!;Qc!G1HBG1N0!
QN0!L:(+P!UR!"%D4#4(!*aR!O#2D24!UgR!6(4!U2)!*R!O#4:2+'2/2+!O!h1??i!X(+.2B
&A()2!'%62'24:!%F!2)%4.(:#%4!F(A:%+!W!(4D!2Y:24&#62!A%4F%+'(:#%4()!
A-(4.2!%F!:-2!+#$%&%'2!DM+#4.!:+(4&)%A(:#%40!S2)!;?c!G?;BG?80!
Q0!*%+2!E3!h;8<i!*%)2AM)(+!'#'#A+/!#4!,+%:2#4!&/4:-2&#&o!LA#24A2!1Q?c!
;H<GB;H<H0!
QI0!EM.)#&#!gZR!3)(4A-(+D!LSR!W+24!"!h1??i!@,,+%(A-#4.!:+(4&)(:#%4!(:!(:%'#A!
+2&%)M:#%40!C(:M+2!L:+MA:M+()!j!*%)2AM)(+!3#%)%./!Qc!I<<BIN;0!
Q80!9(/)%+!ZgR!C#)&&%4!gR!*2+#)!@"R!@4D2+&24!W"R!C#&24!ER!2:!()0!h1?Qi!
L:+MA:M+2&!%F!'%D#F#2D!2>J1!I?L!+#$%&%'2!A%',)2Y2&!+262()!:-2!+%)2!%F!
W9E!-/D+%)/&#&!#4!:+(4&)%A(:#%40!>*35!g%M+4()!1Nc!1H1;B1HG;0!
I?0!J+%)%6(!X^R!*2+PM)%6(!9=R!`#&2)26!X!h1??i!9+(4&)(:#%4!:2+'#4(:#%4!#4!
2MP(+/%:2&c!,%)/,2,:#D2!+2)2(&2!F(A:%+!2"J;!#&!A%',%&2D!%F!FM4A:#%4()/!
(4D!&:+MA:M+()/!D#&:#4A:!D%'(#4&0!"C@!Nc!GI;BG8?0!
I;0!*2+PM)%6(!9=R!J+%)%6(!X^R!X(V(+!*R!S('%4#&!gR!`#&2)26!X!h;88i!SB:2+'#4()!
D%'(#4&!%F!-M'(4!:+(4&)(:#%4!:2+'#4(:#%4!F(A:%+&!2"J;!(4D!2"JG!
'2D#(:2!:-2#+!#4!6#6%!#4:2+(A:#%40!J>3L!X2:2+&!HGc!H;BHQ0!
 
 
168 
I10!L%4.!UR!*M.4#2+!ER!Z(&!@`R!O2$!U*R!>6(4&!Z"R!2:!()0!h1??i!9-2!A+/&:()!
&:+MA:M+2!%F!-M'(4!2MP(+/%:#A!+2)2(&2!F(A:%+!2"J;BB'2A-(4#&'!%F!&:%,!
A%D%4!+2A%.4#:#%4!(4D!,2,:#D/)B:"C@!-/D+%)/&#&0!S2))!;??c!G;;BG1;0!
IG0!=:%!`R!>$#-(+(!`R!C(P('M+(!^!h;8Ii!9-2!&:+2:A-!%F!SB:2+'#4()!(A#D#A!('#4%!
(A#D&!%F!:+(4&)(:#%4()!+2)2(&2!F(A:%+!2"J;!#&!(!,+#'(+/!$#4D#4.!&#:2!F%+!
2"JG!%F!F#&#%4!/2(&:0!"C@!Hc!8<IB8Q10!
IH0!=:%!`R!>$#-(+(!`R!\4%!*R!C(P('M+(!^!h;8Ni!S%4&2+62D!'%:#F&!#4!,+%P(+/%:#A!
(4D!2MP(+/%:#A!,%)/,2,:#D2!+2)2(&2!F(A:%+&c!:"C@B,+%:2#4!'#'#A+/!
-/,%:-2&#&0!E+%A2D#4.&!%F!:-2!C(:#%4()!@A(D2'/!%F!LA#24A2&!%F!:-2!
\4#:2D!L:(:2&!%F!@'2+#A(!8Gc!<HGB<HHI0!
I<0!C(P('M+(!^R!=:%!`R!*(:&M'M+(!`R!`(7(VM!^R!>$#-(+(!`!h;8<i!"2.M)(:#%4!%F!
:+(4&)(:#%4!:2+'#4(:#%4c!A%4&2+62D!&:+MA:M+()!'%:#F&!#4!$(A:2+#()!(4D!
2MP(+/%:#A!,%)/,2,:#D2!+2)2(&2!F(A:%+&0!3#%A-2'#&:+/!j!S2)!3#%)%./!QGc!
;;;GB;;110!
IN0!`#&2)26!XR!3MAP#4.-('!"U!h1??i!9+(4&)(:#%4()!:2+'#4(:#%4!A%'2&!%F!(.20!
9+24D&!#4!3#%A-2'#A()!LA#24A2&!1<c!<N;B<NN0!
IQ0!=:%!`R!J+%)%6(!XR!L2#:BC2$#!@R!`(+('/&-26!@R!`#&2)26!XR!2:!()0!h1?1i!
5'4#,%:24:!D2A%D#4.!,%:24:#()!+2&#D2&!#4!2MP(+/%:#A!:+(4&)(:#%4!
:2+'#4(:#%4!F(A:%+!2"J;!%F!6(+#(4:BA%D2!%+.(4#&'&!(4D!#&!'%DM)(:2D!$/!
:-2!#4:2+(A:#%4&!%F!('#4%!(A#D!&2lM24A2&!7#:-#4!D%'(#4!;0!E+%A2D#4.&!%F!
:-2!C(:#%4()!@A(D2'/!%F!LA#24A2&!%F!:-2!\4#:2D!L:(:2&!%F!@'2+#A(!8c!
IH8HBIH880!
II0!J+%)%6(!XR!L2#:BC2$#!@R!`#&2)26!X!h1?1i!U#.-)/!A%4&2+62D!C=`L!:2:+(,2,:#D2!
#&!FM4A:#%4()/!2&24:#()!#4!2MP(+/%:#A!:+(4&)(:#%4!:2+'#4(:#%4!F(A:%+!2"J;0!
"C@!Ic!;18B;GN0!
I80!L2#:BC2$#!@R!J+%)%6(!XR!`#&2)26!X!h1?1i!S%462+&#%4!%F!%'4#,%:24:!
:+(4&)(:#%4!:2+'#4(:#%4!F(A:%+!2"J;!#4:%!A#)#(:2B)#P2!\W@B%4)/!M4#,%:24:!
2"J;0!>'$%!"2,%+:&!Gc!I;BIIN0!
8?0!S-(6(:2!XR!J+%)%6(!XR!X(M.(!ER!`#&2)26!XR!J(6+2!@!h1?Gi!L:%,!A%D%4&!(4D!
\W!,+%'%:2!2F#A#24:!$#4D#4.!%F!:-2!,%)/,2,:#D2!+2)2(&2!F(A:%+!2"J;!:%!
:-2!+#$%&%'()!@!&#:20!g%M+4()!%F!*%)2AM)(+!3#%)%./!G;c!QH<BQ<I0!
8;0!S-(6(:2!XR!`2+62&:#4!LR!J(6+2!@R!g2(4Bg2(4!5!h1??Gi!L:%,!A%D%4!&2)2A:#%4!#4!
2MP(+/%:#A!:+(4&)(:#%4!:2+'#4(:#%4c!A%',(+#&%4!%F!:-2!D#&A+#'#4(:#4.!
,%:24:#()!$2:724!-M'(4!(4D!A#)#(:2!2"J;&0!>*35!g%M+4()!1c!;NHB
;N<G0!
810!=4.2Ba2A-:%'%6!LR!_-%M+(6)26(!WR!E-#)#,2!*!h1?Gi!>MP(+/%:#A!+2)2(&2!
F(A:%+&!h2"J&i!-#&:%+/0!3#%)%.#A()!S2))!8<c!;8<B1?80!
8G0!S(&P2/!S9R!32(MD2:!@XR!LA%)4#AP!>*R!"%&'(4!*!h;8Q;i!U/D+%)/&#&!%F!F*2:B
:"C@!$/!,2,:#D/)!:+(4&F2+(&20!E+%A2D#4.&!%F!:-2!C(:#%4()!@A(D2'/!%F!
LA#24A2&!%F!:-2!\4#:2D!L:(:2&!%F!@'2+#A(!NIc!G;NGBG;NQ0!
8H0!@+P%6!@XR!J+2#&:+%F2+!ZaR!>-+24$2+.!*R!*M+.%)(!>g!h;8Ii!*M:(:#%4&!#4!
"C@&!%F!$%:-!+#$%&%'()!&M$M4#:&!A(M&2!D2F2A:&!#4!:+(4&)(:#%4!:2+'#4(:#%40!
>*35!g%M+4()!;Qc!;<?QB;<;H0!
8<0!L2#:BC2$#!@R!J+%)%6(!XR!gM&:2&24!gR!`#&2)26!X!h1?;i!S)(&B;!:+(4&)(:#%4!
:2+'#4(:#%4!F(A:%+&c!#46(+#(4:!Wb!'#4#D%'(#4!#&!2&24:#()!F%+!+2)2(&2!
 
 
169 
(A:#6#:/!(4D!+#$%&%'2!$#4D#4.!$M:!4%:!F%+!&:%,!A%D%4!+2A%.4#:#%40!CMA)2#A!
@A#D&!"2&!18c!G8I1BG8IQ0!
8N0!L2#:!C2$#!@R!J+%)%6(!XR!=6(4%6(!CR!E%):(+(M&!@R!`#&2)26!X!h1??i!p*M:(:#%4!%F!(!
.)M:('#42!+2&#DM2!#4!:-2!M4#62+&()!:+#,2,:#D2!Wb!#4!-M'(4!2"J;!
:2+'#4(:#%4!F(A:%+!D%2&!4%:!A(M&2!A%',)2:2!)%&!%F!#:&!(A:#6#:/q0!*%)2AM)(+!
3#%)%./!h*%&P6(i!GHc!I8B8??0!
8Q0!_(6#()%6!@aR!*%+(!XR!3MAP#4.-('!"UR!>-+24$2+.!*!h1?1i!"2)2(&2!%F!
,2,:#D2!,+%'%:2D!$/!:-2!Wb!'%:#F!%F!A)(&!;!+2)2(&2!F(A:%+&!+2.M)(:2&!
:-2!W9E(&2!(A:#6#:/!%F!"JG0!*%)2AM)(+!S2))!;?c!QI8BQ8I0!
8I0!J+%)%6(!X^R!9&#6P%6&P##!"^R!L#6%)%$%6(!WJR!5,(+#4(!C^R!L2+,#4&P/!5=R!2:!()0!
h;88i!*M:(:#%4&!#4!:-2!-#.-)/!A%4&2+62D!Wb!'%:#F!%F!A)(&!;!
,%)/,2,:#D2!+2)2(&2!F(A:%+&!($%)#&-!($#)#:/!%F!-M'(4!2"J;!:%!:+#.2+!
,2,:#D/)B:"C@!-/D+%)/&#&0!"C@!<c!;?;HB;?1?0!
880!L2#:BC2$#!@R!J+%)%6(!XR!gM&:2&24!gR!`#&2)26!X!h1?;i!S)(&B;!:+(4&)(:#%4!
:2+'#4(:#%4!F(A:%+&c!#46(+#(4:!Wb!'#4#D%'(#4!#&!2&24:#()!F%+!+2)2(&2!
(A:#6#:/!(4D!+#$%&%'2!$#4D#4.!$M:!4%:!F%+!&:%,!A%D%4!+2A%.4#:#%40!CMA)2#A!
@A#D&!"2&2(+A-!18c!G8I1BG8IQ0!
;?0!`(,!XZR!X%+&A-!g"!h1?Hi!9-2!'%)2AM)(+!'2A-(4#A&!%F!2MP(+/%:#A!
:+(4&)(:#%40!@44M!"26!3#%A-2'!QGc!N<QBQ?H0!
;?;0!J+2#&:+%FF2+!ZaR!E(6)%6!*^R!*(AZ%M.()!gR!3MAP#4.-('!"UR!>-+24$2+.!*!
h;88Qi!"2)2(&2!F(A:%+!"JG!#4!)*+,-&.+(AA2)2+(:2&!:-2!D#&%A#(:#%4!%F!+2)2(&2!
F(A:%+&!"J;!(4D!"J1!F+%'!:-2!+#$%&%'2!#4!(!W9EBD2,24D24:!'(42+0!
>*35!g%M+4()!;Nc!H;1NBH;GG0!
;?10!_(6#()%6!@aR!3MAP#4.-('!"UR!>-+24$2+.!*!h1?;i!@!,%&:2+'#4(:#%4!
+#$%&%'()!A%',)2Y!#&!:-2!.M(4#42!4MA)2%:#D2!2YA-(4.2!F(A:%+!F%+!,2,:#D2!
+2)2(&2!F(A:%+!"JG0!S2))!;?Qc!;;<B;1H0!
;?G0!`(+#'#!"R!E(6)%6!*^R!3MAP#4.-('!"UR!>-+24$2+.!*!h;88i!C%62)!+%)2&!F%+!
A)(&&#A()!F(A:%+&!(:!:-2!#4:2+F(A2!$2:7224!:+(4&)(:#%4!:2+'#4(:#%4!(4D!
#4#:#(:#%40!*%)2AM)(+!S2))!Gc!N?;BN?80!
;?H0!a()(&2P!XR!*(:-27!@@R!L-#4!3LR!C#2)&24!`UR!LV('2AV!3R!2:!()0!h1?Gi!9-2!
/2(&:!2=JG!&M$M4#:&!9=JG1T(R!C=E;TAR!(4D!2=J<!'(P2!A+#:#A()!A%42A:#%4&!
7#:-!:-2!H?L!+#$%&%'2!#4!6#6%0!W242&!j!Z262)%,'24:!;Qc!QINBQ880!
;?<0!L+#6(&:(6(!LR!a2+&A-%+!@R!J+(4P!g!h;81i!>MP(+/%:#A!#4#:#(:#%4!F(A:%+!G!D%2&!
4%:!,+2624:!(&%A#(:#%4!:-+%M.-!,-/&#A()!$)%AP(.2!%F!:-2!+#$%&%'()!
&M$M4#:B&M$M4#:!#4:2+F(A20!g%M+4()!%F!*%)2AM)(+!3#%)%./!11Nc!G?;BG?H0!
;?N0!U%&-#4%!LR!='(#!*R!`%$(/(&-#!9R!\A-#D(!CR!`(:(D(!9!h;888i!9-2!2MP(+/%:#A!
,%)/,2,:#D2!A-(#4!+2)2(&#4.!F(A:%+!h2"JGTWLE9i!A(++/#4.!:-2!:+(4&)(:#%4!
:2+'#4(:#%4!&#.4()!:%!:-2!GmBE%)/h@i!:(#)!%F!'"C@0!Z#+2A:!(&%A#(:#%4!%F!
2+FGTWLE9!7#:-!,%)/(D24/)(:2B$#4D#4.!,+%:2#40!g%M+4()!%F!3#%)%.#A()!
S-2'#&:+/!1QHc!;NQB;NNI?0!
;?Q0!\A-#D(!CR!U%&-#4%!LR!='(:(P(!UR!L%424$2+.!CR!`(:(D(!9!h1?1i!@!4%62)!+%)2!
%F!:-2!'(''()#(4!WLE9T2"JG!(&%A#(:#4.!7#:-!,%)/h@iB$#4D#4.!,+%:2#4!
#4!S(,TE%)/h@iBD2,24D24:!:+(4&)(:#%40!g%M+4()!%F!3#%)%.#A()!S-2'#&:+/!
1QQc!<?1INB<?1810!
 
 
170 
;?I0!L-%2'(P2+!SgR!>/)2+!Z>R!W+24!"!h1?;?i!Z%'GHcU$&;!,+%'%:2&!&M$M4#:!
D#&&%A#(:#%4!(4D!,2,:#D/)B:"C@!D+%,B%FF!:%!#4#:#(:2!4%B.%!D2A(/0!LA#24A2!
GG?c!GN8BGQ10!
;?80!E#&(+26!@aR!U2)24!S\R!E2&:%6(!9a!h1?Qi!"2A/A)#4.!%F!2MP(+/%:#A!
,%&:2+'#4(:#%4!+#$%&%'()!A%',)2Y2&0!S2)!;G;c!1INB1880!
;;?0!LA-7(+:V!Z>R!9#V(+D!"R!W#)$2+:!O!h;8IGi!CMA)2%:#D2!&2lM24A2!%F!"%M&!
&(+A%'(!6#+M&0!S2)!G1c!I<GBIN80!
;;0!*(+(!*@R!g%42&!LgR!@&:2)!S"R!U%):!"@R!3+%P&BO#)&%4!@R!2:!()0!h1?Gi!9-2!
W24%'2!&2lM24A2!%F!:-2!L@"LB(&&%A#(:2D!A%+%4(6#+M&0!LA#24A2!G?c!
;G88B;H?H0!
;10!g(AP&!9R!E%72+!*ZR!*(&#(+V!J"R!XMA#7!E@R!3(+!EgR!2:!()0!h;8Ii!
S-(+(A:2+#V(:#%4!%F!+#$%&%'()!F+('2&-#F:#4.!#4!U=aB;!.(.B,%)!2Y,+2&&#%40!
C(:M+2!GG;c!1I?B1IG0!
;G0!3+#2+)2/!=R!g242+!@gR!=4.)#&!LS!h;881i!*M:(:#%4()!(4()/&#&!%F!:-2!n&)#,,2+/B
&2lM24A2n!A%',%424:!%F!(!A%+%4(6#+M&!+#$%&%'()!F+('2&-#F:#4.!&#.4()0!g!
*%)!3#%)!11Qc!HNGBHQ80!
;H0!L%'%./#!ER!g242+!@gR!3+#2+)2/!=R!=4.)#&!LS!h;8Gi!"#$%&%'()!,(M&#4.!DM+#4.!
:+(4&)(:#%4!%F!(4!"C@!,&2MD%P4%:0!*%)2AM)(+!j!S2))M)(+!3#%)%./!;Gc!N8G;B
N8H?0!
;<0!32)27!@9R!U2,)2+!CXR!g(A%$&!gXR!Z#4'(4!gZ!h1?Ii!E"JD$c!(!D(:($(&2!%F!
A%',M:(:#%4()/!,+2D#A:2D!2MP(+/%:#A!,+%.+(''2D!B;!+#$%&%'()!
F+('2&-#F:!&#.4()&0!3*S!W24%'#A&!8c!G80!
;N0!g(A%$&!gXR!32)27!@9R!"(P(M&P(#:2!"R!Z#4'(4!gZ!h1?Qi!=D24:#F#A(:#%4!%F!
FM4A:#%4()R!24D%.24%M&!,+%.+(''2D!B;!+#$%&%'()!F+('2&-#F:!&#.4()&!#4!
:-2!.24%'2!%F!L(A-(+%'/A2&!A2+26#&#(20!CMA)2#A!@A#D&!"2&!G<c!;N<B;QH0!
;Q0!*(4P:2)%7!>R!L-#.2'%:%!`R!3+#2+)2/!=!h1?<i!S-(+(A:2+#V(:#%4!%F!:-2!
F+('2&-#F:!&#.4()!%F!>D+R!(!'(''()#(4!2Y(',)2!%F!,+%.+(''2D!B;!
+#$%&%'()!F+('2&-#F:#4.0!CMA)2#A!@A#D&!"2&!Gc!;<GB;<NG0!
;I0!L-#.2'%:%!`R!3+24(4!gR!O()&!>R!O(:&%4!SgR!L:%:!ZR!2:!()0!h1?;i!
=D24:#F#A(:#%4!(4D!A-(+(A:2+#&(:#%4!%F!(!D262)%,'24:()/!+2.M)(:2D!
'(''()#(4!.242!:-(:!M:#)#&2&!B;!,+%.+(''2D!+#$%&%'()!F+('2&-#F:#4.0!
CMA)2#A!@A#D&!"2&2(+A-!18c!H?Q8BH?II0!
;80!O#)&!C*R!*%+2!3R!U(''2+!@R!W2&:2)(4D!"JR!@:P#4&!gJ!h1?Ni!@!FM4A:#%4()!B
;!+#$%&%'()!F+('2&-#F:!&#.4()!#4!:-2!-M'(4!,(+(42%,)(&:#A!*(G!.2420!g!
3#%)!S-2'!1I;c!Q?I1BQ?II0!
;1?0!*(+AV#4P2!3R!3)%/&!@gR!3+%74!9ZR!O#)A%AP&!*R!S(+:2+!*gR!2:!()0!h;8Hi!9-2!
-M'(4!(&:+%6#+M&!"C@BD2,24D24:!"C@!,%)/'2+(&2!A%D#4.!+2.#%4!#&!
2Y,+2&2D!$/!+#$%&%'()!F+('2&-#F:#4.0!g!a#+%)!NIc!<IB<<8<0!
;1;0!3+#2+)2/!=R!Z#.(+D!ER!=4.)#&!LS!h;8I8i!S-(+(A:2+#V(:#%4!%F!(4!2F#A#24:!
A%+%4(6#+M&!+#$%&%'()!F+('2&-#F:#4.!&#.4()c!+2lM#+2'24:!F%+!(4!"C@!
,&2MD%P4%:0!S2))!<Qc!<GQB<HQ0!
;10!:24!Z('!>3R!E)2#[!SOR!3%&A-!X!h;8?i!"C@!,&2MD%P4%:&c!:+(4&)(:#%4()!
F+('2&-#F:#4.!(4D!+2(D:-+%M.-!%4!6#+()!"C@&0!a#+M&!W242&!Hc!;1;B;GN0!
;1G0!`%)'M&!UR!U%4#.'(4!@R!E(42:!@R!U(M&2+!U!h;8Hi!9-2!&2lM24A2&!%F!(4D!
D#&:(4A2!$2:7224!:7%!A#&B(A:#4.!&#.4()&!D2:2+'#42!:-2!2F#A#24A/!%F!
 
 
171 
+#$%&%'()!F+('2&-#F:#4.!#4!-M'(4!#''M4%D2F#A#24A/!6#+M&!:/,2!;!(4D!
-M'(4!9BA2))!)2MP2'#(!6#+M&!:/,2!=!#4!6#6%0!g!a#+%)!NIc!N?IQBN?8;0!
;1H0!g(AP&!9R!*(D-(4#!UZR!*(&#(+V!J"R!a(+'M&!U>!h;8Ii!L#.4()&!F%+!+#$%&%'()!
F+('2&-#F:#4.!#4!:-2!"%M&!&(+A%'(!6#+M&!.(.B,%)!+2.#%40!S2))!<<c!HHQBH<I0!
;1<0!X2.2+!*R!ZM)MD2!ZR!L:2#4$2+.!LaR!3+(P#2+BW#4.+(&!X!h1??Qi!9-2!:-+22!
:+(4&F2+!"C@&!%AM,/#4.!:-2!@R!E!(4D!>!&#:2&!%4!:-2!+#$%&%'2!(+2!
#46%)62D!#4!6#+()!,+%.+(''2D!B;!+#$%&%'()!F+('2&-#F:0!CMA)2#A!@A#D&!"2&!
G<c!<<I;B<<810!
;1N0!*(+AV#4P2!3R!U(.2+6()!9R!3+#2+)2/!=!h1???i!9-2!bB$(&2!%F!(&,(+(.#4/)B:"C@!
#&!D#&,24&($)2!F%+!2FF#A#24:!B;!+#$%&%'()!F+('2&-#F:#4.!#4!2MP(+/%:2&0!g!*%)!
3#%)!18<c!;Q8B;8;0!
;1Q0!ZM)MD2!ZR!3(+#)!*R!3+(P#2+BW#4.+(&!X!h1??1i!S-(+(A:2+#V(:#%4!%F!:-2!
F+('2&-#F:!&:#'M)(:%+/!&#.4()!A%4:+%)#4.!(!,+%.+(''2D!B;!+#$%&%'()!
F+('2&-#F:!#4!:-2!-M'(4!#''M4%D2F#A#24A/!6#+M&!:/,2!;0!CMA)2#A!@A#D&!
"2&!G?c!<?8HB<;?10!
;1I0!J(+($(M.-!Eg!h1??i!9+(4&)(:#%4()!F+('2&-#F:#4.c!#',)#A(:#%4&!F%+!:-2!
'2A-(4#&'!%F!:+(4&)(:#%4()!F+('2!'(#4:24(4A20!E+%.+2&!#4!CMA)2#A!@A#D!
"2&2(+A-!(4D!*%)2AM)(+!3#%)%./!NHc!;G;B;Q?0!
;180!E(M)!SER!3(++/!g`R!Z#42&-B`M'(+!LER!3+(M):!aR!*#)2+!O@!h1?;i!@!&2lM24A2!
+2lM#+2D!F%+!B;!+#$%&%'()!F+('2&-#F:#4.!)%A(:2D!F%M+!P#)%$(&2&!
D%74&:+2('!%F!:-2!F+('2&-#F:!&#:20!g%M+4()!%F!*%)2AM)(+!3#%)%./!G;?c!8IQB
8880!
;G?0!3+#2+)2/!=R!W#)$2+:!"gSR!E2442))!L!h1?;?i!E&2MD%P4%:BZ2,24D24:!
E+%.+(''2D!B;!"#$%&%'()!J+('2&-#F:#4.c!L:+MA:M+2&R!*2A-(4#&'&!(4D!
*%D2)&0!=4c!@:P#4&!gJR!W2&:2)(4D!"JR!2D#:%+&0!"2A%D#4.c!>Y,(4&#%4!%F!
Z2A%D#4.!"M)2&!>4+#A-2&!W242!>Y,+2&&#%40!C27!^%+Pc!L,+#4.2+0!,0!;H8B
;QH0!
;G;0!E)(4:!>ER!g(A%$&!`X*R!U(+.2+!gOR!*2&P(M&P(&!@R!g(A%$&!gXR!2:!()0!h1?Gi!9-2!
8Bk!&%)M:#%4c!U%7!'"C@!,&2MD%P4%:&!,+%'%:2!2F#A#24:!,+%.+(''2D!B;!
+#$%&%'()!F+('2&-#F:#4.0!"C@!8c!;NIB;QH0!
;G10!U(+.2+!gOR!*2&P(M&P(&!@R!Z#4'(4!gZ!h1?1i!@4!m#4:2.+(:2D!'%D2)m!%F!
,+%.+(''2D! +#$%&%'()! F+('2&-#F:#4.! (4D! ,%&:B:+(4&A+#,:#%4()!
&M+62#)(4A20!9+24D&!#4!3#%A-2'#A()!LA#24A2&!1Qc!HIBH<H0!
;G0!Z#4'(4!gZR!`#4V/!9W!h;8Qi!9+(4&)(:#%4()!'#&+2(D#4.c!*M:(:#%4&!#4!
:+(4&)(:#%4!2)%4.(:#%4!F(A:%+!;(),-(!D#F2+24:#()/!(F2A:!,+%.+(''2D!
+#$%&%'()!F+('2&-#F:#4.!(4D!D+M.!&24&#:#6#:/0!"C@!Gc!IQ?BII;0!
;GH0!*2&P(M&P(&!@R!U(+.2+!gOR!g(A%$&!`X*R!Z#4'(4!gZ!h1?Gi!Z2A+2(&2D!
,2,:#D/):+(4&F2+(&2!(A:#6#:/!A%+2)(:2&!7#:-!#4A+2(&2D!,+%.+(''2D!B;!
+#$%&%'()!F+('2&-#F:#4.!(4D!6#+()!'(#4:24(4A2!D2F2A:&!#4!:-2!/2(&:!!
L(A-(+%'/A2&!A2+26#&#(2!"C@!8c!8I1B8810!
;G<0!5+:#V!E@R!\)%lM2!"R!`#-(+(!W`R!_-24.!UR!`#4V/!9W!h1?Ni!9+(4&)(:#%4!
2)%4.(:#%4!F(A:%+!1!(4:#A%D%4!'#'#A+/!D%'(#4!'M:(4:&!(F2A:!F#D2)#:/!(4D!
D#,-:-2+#(!:%Y#4!+2&#&:(4A20!g%M+4()!%F!3#%)%.#A()!S-2'#&:+/!1I;c!G1NG8B
G1NHI0!
 
 
172 
;GN0!O2#&!"3R!ZM4!Z*R!L-M-!*R!@:P#4&!gJR!W2&:2)(4D!"J!h;8I8i!>0!A%)#!
+#$%&%'2&!+2B,-(&2!%4!+2:+%6#+()!F+('2&-#F:!&#.4()&!(:!+(:2&!+(4.#4.!F+%'!
1!:%!<?!,2+A24:0!9-2!C27!3#%)%.#&:!;c!;<8B;N80!
;GQ0!J(+($(M.-!Eg!h;8Ni!E+%.+(''2D!:+(4&)(:#%4()!F+('2&-#F:#4.0!*#A+%$#%)%./!
"26#27!N?c!;?GB;GH0!
;GI0!C('/!5R!*%+(4!LgR!L:M(+:!Z=R!W#)$2+:!"gR!3+#2+)2/!=!h1?Ni!@!'2A-(4#A()!
2Y,)(4(:#%4!%F!"C@!,&2MD%P4%:!FM4A:#%4!#4!,+%.+(''2D!+#$%&%'()!
F+('2&-#F:#4.0!C(:M+2!H;c!1HB1HQ0!
;G80!*%+(4!LgR!J)(4(.(4!gJ:R!C('/!5R!L:M(+:!Z=R!3+#2+)2/!=R!2:!()0!h1?Ii!9-2!
'2A-(4#A&!%F!:+(4&)%A(:#%4c!(!'%)2AM)(+!n&,+#4.B(4DB+(:A-2:n!&/&:2'0!
L:+MA:M+2!;Nc!NNHBNQ10!
;H?0!X#(%!E^R!S-%#!^LR!Z#4'(4!gZR!X2!`U!h1?;?i!9-2!'(4/!,(:-&!:%!
F+('2&-#F:#4.c!P#42:#A!'%D2)#4.!(4D!(4()/&#&!%F!:-2!2FF2A:&!%F!D#FF2+24:!
2)%4.(:#%4!&:2,&!%4!,+%.+(''2D!B;!+#$%&%'()!F+('2&-#F:#4.0!CMA)2#A!
@A#D&!"2&2(+A-0!
;H;0!J(+($(M.-!EgR!_-(%!UR!a#'()(D#:-(4!@!h;8Gi!@!4%62)!,+%.+('2D!F+('2&-#F:!
2Y,+2&2&!:-2!E5XG!.242!%F!+2:+%:+(4&,%&%4!9/G!%F!/2(&:c!F+('2&-#F:#4.!
7#:-%M:!:"C@!&)#,(.20!S2)!QHc!8GB;?G0!
;H10!O(4.!]R!O%4.!L*R!X#M!Z]!h1??Ni!=D24:#F#A(:#%4!%F!U2,:(B!(4D!5A:%B\+#D#42!
&:+2:A-2&!(&!&%)2!&#.4()&!F%+!,+%.+(''2D!K;!(4D!B;!+#$%&%'()!
F+('2&-#F:#4.!DM+#4.!:+(4&)(:#%4!%F!L@"LBS%a!5"J!G(!6(+#(4:&0!CMA)2#A!
@A#D&!"2&2(+A-!GHc!;1<?B;1N?0!
;HG0!ZM4!gR!L:MD#2+!JO!h;8IGi!S%',)2:2!4MA)2%:#D2!&2lM24A2!%F!$(A:2+#%,-(.2!
9Q!ZC@!(4D!:-2!)%A(:#%4&!%F!9Q!.242:#A!2)2'24:&0!g%M+4()!%F!*%)2AM)(+!
3#%)%./!;Nc!HQB<G<0!
;H0!g(AP&!9R!a(+'M&!U>!h;8I<i!>Y,+2&#%4!%F!:-2!"%M&!&(+A%'(!6#+M&!,%)!.242!
$/!+#$%&%'()!F+('2&-#F:#4.0!LA#24A2!1G?c!;1GQB;1H10!
;H<0!S+(#.24!OgR!S(&P2/!S9!h;8INi!>Y,+2&&#%4!%F!,2,:#D2!A-(#4!+2)2(&2!F(A:%+!1!
+2lM#+2&!-#.-B2F#A#24A/!F+('2&-#F:0!C(:M+2!G1c!1QGB1Q<0!
;HN0!a#'()(D#:-(4!@R!J(+($(M.-!Eg!h;8Hi!L,2A#()!,2,:#D/)B:"C@!'%)2AM)2&!A(4!
,+%'%:2!:+(4&)(:#%4()!F+('2&-#F:#4.!7#:-%M:!&)#,(.20!*%)2AM)(+!j!
S2))M)(+!3#%)%./!;Hc!I;?QBI;;N0!
;HQ0!@&(PM+(!9R!L(&(P#!9R!C(.(4%!JR!L(:%-!@R!5$(#&-#!UR!2:!()0!h;8Ii!=&%)(:#%4!(4D!
A-(+(A:2+#V(:#%4!%F!(!4%62)!(A:#4!F#)('24:B$#4D#4.!,+%:2#4!F+%'!
L(A-(+%'/A2&!A2+26#&#(20!54A%.242!;Nc!;1;B;G?0!
;HI0!`(:V!g>R!Z)(P#A!*R!S)(+P2!L!h1?Gi!@M:%'(:2D!#D24:#F#A(:#%4!%F!,M:(:#62!
'2:-/):+(4&F2+(&2&!F+%'!.24%'#A!%,24!+2(D#4.!F+('2&0!*%)2AM)(+!j!
S2)M)(+!E+%:2%'#A&!1c!<1<B<H?0!
;H80!*(:&MFM[#!LR!*(:&MFM[#!9R!*#/(V(P#!^R!*M+(P('#!^R!@:P#4&!gJR!2:!()0!h;8<i!
@M:%+2.M)(:%+/!F+('2&-#F:#4.!#4!D2A%D#4.!'(''()#(4!%+4#:-#42!
D2A(+$%Y/)(&2!(4:#V/'20!S2)!I?c!<;BN?0!
;<?0!S)(+2!gR!J(+($(M.-!E!h;8I<i!CMA)2%:#D2!&2lM24A2!%F!(!/2(&:!9/!2)2'24:c!
26#D24A2!F%+!(4!M4M&M()!'2A-(4#&'!%F!.242!2Y,+2&#%40!E+%A!C(:)!@A(D!
LA#!\!L!@!I1c!1I18B1IGG0!
;<;0!3%2P2!gZR!W(+F#4P2)!ZgR!L:/)2&!S@R!J#4P!W"!h;8I<i!9/!2)2'24:&!:+(4&,%&2!
:-+%M.-!(4!"C@!#4:2+'2D#(:20!S2)!H?c!H8;B<??0!
 
 
173 
;<10!32)A%M+:!*JR!J(+($(M.-!Eg!h;8?i!"#$%&%'()!F+('2&-#F:#4.!#4!:-2!/2(&:!
+2:+%:+(4&,%&%4!9/c!:"C@&!#4DMA2!&)#,(.2!%4!(!Q!4MA)2%:#D2!'#4#'()!
&#:20!S2))!N1c!GG8BG<10!
;<G0!`(7(P('#!`R!E(4D2!LR!J(#%)(!3R!*%+2!ZER!3%2P2!gZR!2:!()0!h;8Gi!@!+(+2!
:"C@B@+.hS\i!:-(:!+2.M)(:2&!9/;!2)2'24:!+#$%&%'()!F+('2&-#F:#4.!#&!
2&&24:#()!F%+!9/;!+2:+%:+(4&,%&#:#%4!#4!L(A-(+%'/A2&!A2+26#&#(20!
W242:#A&!;G<c!G?8BG1?0!
;<H0!J(+($(M.-!Eg!h1?;?i!E+%.+(''2D!J+('2&-#F:#4.!#4!3MD#4.!^2(&:0!=4c!
@:P#4&!gJR!W2&:2)(4D!"JR!2D#:%+&0!"2A%D#4.c!>Y,(4&#%4!%F!Z2A%D#4.!"M)2&!
>4+#A-2&!W242!>Y,+2&&#%40!C27!^%+Pc!L,+#4.2+0!,,0!11;B1HQ0!
;<0!Z%4)/!3SR!>D.(+!SZR!@D('&P#!J*R!9(:2!OE!h;8?i!J+('2&-#F:!
(M:%+2.M)(:#%4!#4!:-2!.242!F%+!>&A-2+#A-#(!A%)#!+2)2(&2!F(A:%+!1c!,(+:)/!
FM4A:#%4()!'M:(4:&!+2&M):!#4!F+('2&-#F:!24-(4A2'24:0!CMA)2#A!@A#D&!"2&!
;Ic!N<;QBN<110!
;<N0!=6(4%6!=ER!*(:&MFM[#!LR!*M+(P('#!^R!W2&:2)(4D!"JR!@:P#4&!gJ!h1??i!
S%4&2+6(:#%4!%F!,%)/('#42!+2.M)(:#%4!$/!:+(4&)(:#%4()!F+('2&-#F:#4.!F+%'!
/2(&:!:%!'(''()&0!>*35!g%M+4()!;8c!;8?QB;8;Q0!
;<Q0!E2.!@>!h;8INi!"2A24:!(D6(4A2&!#4!:-2!$#%A-2'#&:+/!%F!,%)/('#42&!#4!
2MP(+/%:2&0!3#%A-2'#A()!g%M+4()!1GHc!1H8B1N10!
;<I0!U(/(&-#!LR!*M+(P('#!^!h;8<i!"(,#D!(4D!+2.M)(:2D!D2.+(D(:#%4!%F!
%+4#:-#42!D2A(+$%Y/)(&20!3#%A-2'#A()!g%M+4()!G?N!h!E:!;ic!;B;?0!
;<80!U2))2+!gLR!J%4.!OJR!S(42))(P#&!>L!h;8QNi!=4DMA:#%4!%F!(!,+%:2#4!#4-#$#:%+!:%!
%+4#:-#42!D2A(+$%Y/)(&2!$/!:-2!24D!,+%DMA:&!%F!#:&!+2(A:#%40!E+%A22D#4.&!
%F!:-2!C(:#%4()!@A(D2'/!%F!LA#24A2&!%F!:-2!\4#:2D!L:(:2&!%F!@'2+#A(!QGc!
;I<IB;IN10!
;N?0!3()(&M4D(+('!ZR!Z#4'(4!gZR!9($%+!SOR!9($%+!U!h;8Hi!LE>;!(4D!LE>1c!
:7%!2&24:#()!.242&!#4!:-2!$#%&/4:-2&#&!%F!,%)/('#42&!:-(:!'%DM)(:2!K;!
+#$%&%'()!F+('2&-#F:#4.!#4!L(A-(+%'/A2&!A2+26#&#(20!g%M+4()!%F!
3(A:2+#%)%./!;QNc!Q;1NBQ;1I0!
;N;0!"%'!>R!`(-(4(!S!h;8Hi!E%)/('#42&!+2.M)(:2!:-2!2Y,+2&#%4!%F!%+4#:-#42!
D2A(+$%Y/)(&2!(4:#V/'2!#4!6#:+%!$/!#4DMA#4.!+#$%&%'()!F+('2B&-#F:#4.0!
E+%A2D#4.&!%F!:-2!C(:#%4()!@A(D2'/!%F!LA#24A2&!%F!:-2!\4#:2D!L:(:2&!%F!
@'2+#A(!8;c!G8<8BG8NG0!
;N10!J24.!^]R!^M(4!UR!"2#4!@R!X26#4!gW!h;81i!3#,(+:#:2!&#.4()!F%+!+2(DB:-+%M.-!
&M,+2&#%4!#4!'M+#42!)2MP2'#(!6#+M&!'"C@c!(4!2#.-:B4MA)2%:#D2!,M+#42B
+#A-!&2lM24A2!#''2D#(:2)/!D%74&:+2('!%F!:-2!.(.!:2+'#4(:#%4!A%D%4!
F%)%72D!$/!(4!"C@!,&2MD%P4%:0!g%M+4()!%F!a#+%)%./!Nc!<;1QB<;G10!
;NG0!E-#)#,&%4!XR!@4D2+&%4!ER!5)&-26&P/!\R!O2#4$2+.!"R!3():#'%+2!ZR!2:!()0!
h;8QIi!9+(4&)(:#%4!%F!*MXa!(4D!*La!"C@&!#4!4MA)2(&2B:+2(:2D!
+2:#AM)%A/:2!2Y:+(A:&c!24-(4A2'24:!%F!:-2!.(.B,%)!,%)/,2,:#D2!7#:-!/2(&:!
&M,+2&%+!:"C@0!S2)!;Gc!;I8B;880!
;NH0!^%&-#4(P(!^R!`(:%-!=R!S%,2)(4D!9ZR!5+%&V)(4!L!h;8I<i!*M+#42!)2MP2'#(!
6#+M&!,+%:2(&2!#&!24A%D2D!$/!:-2!.(.B,%)!.242!(4D!#&!&/4:-2&#V2D!:-+%M.-!
&M,+2&#%4!%F!(4!('$2+!:2+'#4(:#%4!A%D%40!E+%A2D#4.&!%F!:-2!C(:#%4()!
@A(D2'/!%F!LA#24A2&!%F!:-2!\4#:2D!L:(:2&!%F!@'2+#A(!I1c!;N;IB;N110!
 
 
174 
;N<0!O#)&!C*R!W2&:2)(4D!"JR!@:P#4&!gJ!h;8;i!>6#D24A2!:-(:!(!D%74&:+2('!
,&2MD%P4%:!#&!+2lM#+2D!F%+!:+(4&)(:#%4()!+2(DB:-+%M.-!%F!:-2!*%)%42/!
'M+#42!)2MP2'#(!6#+M&!.(.!&:%,!A%D%40!E+%A2D#4.&!%F!:-2!C(:#%4()!
@A(D2'/!%F!LA#24A2&!%F!:-2!\4#:2D!L:(:2&!%F!@'2+#A(!Ic!N8;BN88<0!
;N0!32#2+!UR!W+#''!*!h1?;i!*#&+2(D#4.!%F!:2+'#4(:#%4!A%D%4&!#4!2MP(+/%:2&!
$/!4(:M+()!4%4&24&2!&M,+2&%+!:"C@&0!CMA)2#A!@A#D&!"2&!18c!HQNQBHQI10!
;NQ0!U(:F#2)D!ZXR!W)(D/&-26!aC!h1?1i!U%7!&2)24#M'!-(&!():2+2D!%M+!
M4D2+&:(4D#4.!%F!:-2!.242:#A!A%D20!*%)2AM)(+!j!S2))M)(+!3#%)%./!1c!G<N<B
G<QN0!
;NI0!"%:-2+!*R!`+V/AP#!g@!h1?;?i!L2)24%A/&:2#42R!,/+%)/&#42R!(4D!:-2!M4#lM2!
242+./!'2:($%)#&'!%F!'2:-(4%.24#A!(+A-(2(0!@+A-(2(!1?;?c!;H0!
;N80!L2+.#26!EaR!`#,(+#&%6!LaR!3M+(P%6&P/!Z>R!X2&4/(P!ZaR!X2%4%6!@@R!2:!()0!
h1??<i!9-2!A%4&2+62D!@B&#:2!F#4.2+!%F!:-2!1GL!+"C@c![M&:!%42!%F!:-2!
#4:2+&M$M4#:!$+#D.2&!%+!(!,(+:!%F!:-2!()%&:2+#A!A%''M4#A(:#%4!,(:-7(/o!
g%M+4()!%F!*%)2AM)(+!3#%)%./!G<Gc!;;NB;1G0!
;Q?0!`)2#4!ZgR!*%+2!E3R!L:2#:V!9@!h1?Hi!9-2!+%)2&!%F!+#$%&%'()!,+%:2#4&!#4!:-2!
&:+MA:M+2!(&2'$)/R!(4D!26%)M:#%4!%F!:-2!)(+.2!+#$%&%'()!&M$M4#:0!g%M+4()!
%F!*%)2AM)(+!3#%)%./!GH?c!;H;B;QQ0!
;Q;0!Z%4:&%6(!5@R!Z#4'(4!gZ!h1?<i!<L!+"C@c!&:+MA:M+2!(4D!FM4A:#%4!F+%'!-2(D!
:%!:%20!=4:2+4(:#%4()!g%M+4()!%F!3#%'2D#A()!LA#24A2!;!1BQ0!
;Q10!L2)'2+!*R!ZM4-('!S*R!*M+,-/!JaR!O2#Y)$(M'2+!@R!E2:+/!LR!2:!()0!h1?Ni!
L:+MA:M+2!%F!:-2!Q?L!+#$%&%'2!A%',)2Y2D!7#:-!'"C@!(4D!:"C@0!LA#24A2!
G;Gc!;8G<B;8H10!
;QG0!X2+!"gR!"('&D%4PBZM#4!*R!*(.2+!OUR!E)(4:(!"g!h;8IHi!9-2!,+#'(+/!
&:+MA:M+2!%F!:-2!.242!24A%D#4.!/2(&:!+#$%&%'()!,+%:2#4!X;N0!J>3L!X2:2+&!
;Q<c!GQ;BGQN0!
;QH0!"%:24$2+.!*5R!*%+#:V!*R!O%%)F%+D!gXR!g+0!h;8IIi!Z2,)2:#%4!%F!
L(A-(+%'/A2&!A2+26#&#(2!+#$%&%'()!,+%:2#4!X;N!A(M&2&!(!D2A+2(&2!#4!N?L!
+#$%&%'()!&M$M4#:&!(4D!F%+'(:#%4!%F!-()FB'2+!,%)/+#$%&%'2&0!W242&!j!
Z262)%,'24:!1c!;N?B;Q10!
;Q<0!*%+#:V!*R!EM)(&P#!3@R!O%)F%+D!gXR!g+0!h;8;i!@&&2'$)/!%F!N?L!+#$%&%'()!
&M$M4#:&!#&!,2+:M+$2D!#4!:2',2+(:M+2B&24&#:#62!/2(&:!'M:(4:&!D2F2A:#62!#4!
+#$%&%'()!,+%:2#4!X;N0!*%)2AM)(+!j!S2)M)(+!3#%)%./!;c!<NI;B<N810!
;QN0!O#)#('&!*>R!LM&2Y!=*!h;8<i!Z262)%,'24:()!+2.M)(:#%4!%F!+#$%&%'()!
,+%:2#4!X;N!.242&!#4!@+($#D%,&#&!:-()#(4(0!E)(4:!g%M+4()!Ic!N<BQN0!
;Q0!3-(:!`ER!=:(-(4(!`R!g#4!@R!_-(4.!^!h1?Hi!>&24:#()!+%)2!%F!+#$%&%'()!,+%:2#4!
X;!#4!'2D#(:#4.!.+%7:-!#4-#$#:#%4B#4DMA2D!,<G!(A:#6(:#%40!>*35!g%M+4()!
1Gc!1H?1B1H;10!
;QI0!W(VD(!U9R!L-24!*"R!a)(A-%&!@R!S-%2&'2)!aR!5mZ%4%-M2!*JR!2:!()0!h1?Ii!
"#$%&%'()!,+%:2#4!X<!(4D!X;!'M:(:#%4&!(+2!(&%A#(:2D!7#:-!A)2F:!,()(:2!
(4D!($4%+'()!:-M'$&!#4!Z#('%4DB3)(APF(4!(42'#(!,(:#24:&0!@'2+#A(4!
g%M+4()!%F!UM'(4!W242:#A&!IGc!QN8BQI?0!
;Q80!Z#4'(4!gZR!O#AP42+!"3!h;81i!"#$%&%'()!F+('2&-#F:#4.!2F#A#24A/!(4D!
W(.TW(.B,%)!+(:#%!(+2!A+#:#A()!F%+!/2(&:!*;!D%M$)2B&:+(4D2D!"C@!6#+M&!
,+%,(.(:#%40!g%M+4()!%F!a#+%)%./!NNc!GN8BGNQN0!
 
 
175 
;I?0!U(+.2+!gOR!Z#4'(4!gZ!h1?Gi!@4!#4!6#6%!DM()B)MA#F2+(&2!(&(/!&/&:2'!F%+!
&:MD/#4.!:+(4&)(:#%4()!+2A%D#4.!#4!:-2!/2(&:!!L(A-(+%'/A2&!A2+26#&#(2!
"C@!8c!;?;8B;?1H0!
;I;0!L:(.2B_#''2+'(4!9R!LA-'#D:!\R!L#)62+!E@!h1??i!J(A:%+&!(F2A:#4.!4MA)2(+!
2Y,%+:!%F!:-2!N?L!+#$%&%'()!&M$M4#:!#4!6#6%0!*%)2AM)(+!3#%)%./!%F!:-2!S2)!
;;c!GQQQBGQI80!
;I10!L#P%+&P#!"LR!U#2:2+!E!h;8I8i!@!&/&:2'!%F!&-M:)2!62A:%+&!(4D!/2(&:!-%&:!
&:+(#4&!D2&#.42D!F%+!2F#A#24:!'(4#,M)(:#%4!%F!ZC@!#4!L(A-(+%'/A2&!
A2+26#&#(2!W242:#A&!;11c!;8B1Q0!
;IG0!"%&2!*ZR!O#4&:%4!JR!U#2:2+!E!h;88?i!*2:-%D&!#4!^2(&:!W242:#A&0!S%)D!L,+#4.!
U(+$%+R!C^c!S%)D!L,+#4.!U(+$%+!E+2&&0!;8I!,0!
;IH0!E)(4:!>ER!C.M/24!ER!"M&!g"R!E#:'(4!^"R!C.M/24!9R!2:!()0!h1?Qi!
Z#FF2+24:#(:#4.!$2:7224!42(+B!(4D!4%4BA%.4(:2!A%D%4&!#4!L(A-(+%'/A2&!
A2+26#&#(2!EX%L!5C>!1c!2<;Q0!
;I<0!g(A%$&!gXR!Z#4'(4!gZ!h1?Hi!L/&:2'(:#A!(4()/&#&!%F!$#A#&:+%4#A!+2,%+:2+!
(&(/!D(:(0!CMA)2#A!@A#D&!"2&2(+A-!G1c!2;N?B2;Q?0!
;IN0!X2&-#4!g@R!"(P(M&P(#:2!"R!Z#4'(4!gZR!*2&P(M&P(&!@!h1?;?i!>4-(4A2D!
,M+#:/R!(A:#6#:/!(4D!&:+MA:M+()!#4:2.+#:/!%F!/2(&:!+#$%&%'2&!,M+#F#2D!M&#4.!
(!.242+()!A-+%'(:%.+(,-#A!'2:-%D0!"C@!3#%)%./!Qc!G<HBGN?0!
;IQ0!J%#(4#!*R!S#.(4!@*R!E(D%4!SgR!U(+(&-#'(!LR!U#42$M&A-!@W!h;8;i!WSZ1R!
(!:+(4&)(:#%4()!+2,+2&%+!%F!:-2!WSCH!.242R!-(&!(!.242+()!FM4A:#%4!#4!:-2!
#4#:#(:#%4!%F!,+%:2#4!&/4:-2&#&!#4!L(A-(+%'/A2&!A2+26#&#(20!*%)2AM)(+!j!
S2))M)(+!3#%)%./!;;c!G1?GBG1;N0!
;II0!9+#(4(B@)%4&%!JgR!L,(-4!S*R!3M+P-(+D:!CR!"%-+D(4V!3R!C#2+-(M&!`U!h1??i!
>Y,2+#'24:()!,+2+2lM#&#:2&!F%+!D2:2+'#4(:#%4!%F!:"C@!$#4D#4.!:%!
+#$%&%'2&!F+%'!>&A-2+#A-#(!A%)#0!*2:-%D&!>4V/'%)%./!G;Qc!1N;B1QN0!
;I80!Z+2&#%&!gR!Z2+P(:A-!=XR!X#2$'(4!LOR!L/42:%&!Z!h1??i!^2(&:!+#$%&%'()!
,+%:2#4!X1H!(F2A:&!:-2!P#42:#A&!%F!,+%:2#4!&/4:-2&#&!(4D!+#$%&%'()!
,+%:2#4!XG8!#',+%62&!:+(4&)(:#%4()!(AM+(A/R!7-#)2!'M:(4:&!)(AP#4.!$%:-!
+2'(#4!6#($)20!3#%A-2'#&:+/!G8c!Q1GNBQ1HH0!
;8?0!Z2X(4%!OX!h1?Ni!9-2!E/*5X!*%)2AM)(+!W+(,-#A&!L/&:2'0!
;8;0!S(+:2+!@ER!S)2'%4&!O*R!3+%D2+&24!Z>R!*%+.(4BO(+24!"gR!O#'$2+)/!39R!2:!
()0!h1??i!JM4A:#%4()!#4&#.-:&!F+%'!:-2!&:+MA:M+2!%F!:-2!G?L!+#$%&%'()!
&M$M4#:!(4D!#:&!#4:2+(A:#%4&!7#:-!(4:#$#%:#A&0!C(:M+2!H?Qc!GH?BGHI0!
;810!W+%)'(4!@E!h;8NQi!=4-#$#:%+&!%F!,+%:2#4!$#%&/4:-2&#&0!=0!*%D2!%F!(A:#%4!%F!
(4#&%'/A#40!g%M+4()!%F!3#%)%.#A()!S-2'#&:+/!1H1c!G1NBG1GG0!
;8G0!U(4&24!gXR!*%+2!E3R!L:2#:V!9@!h1?Gi!L:+MA:M+2&!%F!F#62!(4:#$#%:#A&!$%M4D!
(:!:-2!,2,:#D/)!:+(4&F2+(&2!A24:2+!%F!:-2!)(+.2!+#$%&%'()!&M$M4#:0!g%M+4()!
%F!*%)2AM)(+!3#%)%./!GG?c!;?N;B;?Q<0!
;8H0!LA-)M4V24!JR!_(+#6(A-!"R!U(+'&!"R!3(&-(4!@R!9%A#)[!@R!2:!()0!h1?;i!
L:+MA:M+()!$(&#&!F%+!:-2!#4:2+(A:#%4!%F!(4:#$#%:#A&!7#:-!:-2!,2,:#D/)!
:+(4&F2+(&2!A24:+2!#4!2M$(A:2+#(0!C(:M+2!H;Gc!I;HBI1;0!
;8<0!O#AP42+!"3!h;88Ni!Z%M$)2B&:+(4D2D!"C@!6#+M&2&!%F!!L(A-(+%'/A2&!
A2+26#&#(2!*#A+%$#%)%.#A()!"26#27&!N?c!1<?B1N<0!
;8N0!Z#4'(4!gZR!=A-%!9R!O#AP42+!"3!h;8;i!@!B;!+#$%&%'()!F+('2&-#F:!#4!(!
D%M$)2B&:+(4D2D!"C@!6#+M&!F%+'&!(!W(.B,%)!FM&#%4!,+%:2#40!E+%A22D#4.&!
 
 
176 
%F!:-2!C(:#%4()!@A(D2'/!%F!LA#24A2&!%F!:-2!\4#:2D!L:(:2&!%F!@'2+#A(!Ic!
;QHB;QI0!
;8Q0!3+2#4#.!JR!9#,2+!ZgR!LA-'#:!*g!h1?1i!`+2;,R!:-2!,)(&'(!'2'$+(42!
+2A2,:%+!F%+!:-2!/2(&:!`;!6#+()!:%Y#40!S2))!;?Ic!G8<BH?<0!
;8I0!U(+.2+!gOR!Z#4'(4!gZ!h1?Hi!>6#D24A2!(.(#4&:!(!D#+2A:!+%)2!F%+!:-2!\,F!
,+%:2#4&!#4!F+('2&-F#:#4.!%+!4%4&24&2!A%D%4!+2(D:-+%M.-0!"C@!;?c!;Q1;B
;Q180!
;80!L,#+#4!@L!h;8Qi!p9+(4&)%A(:#%4!'2A-(4#&'!%F!+#$%&%'2&q0!*%)2AM)(+!
3#%)%./!h*%&P6(i!;;c!;G<B;GHG0!
1??0!*2+#4%!>gR!O#)P#4&%4!`@R!S%M.-)(4!gXR!O2P&!`*!h1?<i!"C@!&:+MA:M+2!
(4()/&#&!(:!&#4.)2!4MA)2%:#D2!+2&%)M:#%4!$/!&2)2A:#62!1mB-/D+%Y/)!(A/)(:#%4!
(4D!,+#'2+!2Y:24&#%4!hLU@E>i0!g%M+4()!%F!:-2!@'2+#A(4!S-2'#A()!L%A#2:/!
;1Qc!H11GBH1G;0!
1?;0!*%+:#'2+!L@R!O2P&!`*!h1?Qi!@!F(&:B(A:#4.!+2(.24:!F%+!(AAM+(:2!(4()/&#&!
%F!"C@!&2A%4D(+/!(4D!:2+:#(+/!&:+MA:M+2!$/!LU@E>!A-2'#&:+/0!g%M+4()!%F!
:-2!@'2+#A(4!S-2'#A()!L%A#2:/!;18c!H;HBH;H<0!
1?10!O#)P#4&%4!`@R!*2+#4%!>gR!O2P&!`*!h1?Ni!L2)2A:#62!1mB-/D+%Y/)!(A/)(:#%4!
(4()/V2D!$/!,+#'2+!2Y:24&#%4!hLU@E>ic!lM(4:#:(:#62!"C@!&:+MA:M+2!
(4()/&#&!(:!&#4.)2!4MA)2%:#D2!+2&%)M:#%40!C(:M+2!E+%:%A%)&!;c!;N;?B;N;N0!
1?G0!5.)2!g*R!*M+,-/!JaR!9(+/!*gR!"('(P+#&-4(4!a!h1?1i!L2)2A:#%4!%F!:"C@!$/!
:-2!"#$%&%'2!"2lM#+2&!(!9+(4&#:#%4!F+%'!(4!5,24!:%!(!S)%&2D!J%+'0!S2)!
;;;c!Q1;BQG10!
1?H0!*2&P(M&P(&!@R!"M&!g"R!Z#4'(4!gZ!h1?Ii!L:+MA:M+2TFM4A:#%4!(4()/&#&!%F!
/2(&:!+#$%&%'()!,+%:2#4!X10!CMA)2#A!@A#D&!"2&2(+A-!GNc!;I1NB;IG<0!
1?<0!"(P(M&P(#:2!"R!Z#4'(4!gZ!h1?Ni!@4!(+A!%F!M4,(#+2D!n-#4.2!$(&2&n!
F(A#)#:(:2&!#4F%+'(:#%4!2YA-(4.2!('%4.!FM4A:#%4()!A24:2+&!%F!:-2!
+#$%&%'20!*%)2AM)(+!j!S2)M)(+!3#%)%./!1Nc!I81B8??10!
1?N0!X#(%!E^R!WM,:(!ER!E2:+%6!@CR!Z#4'(4!gZR!X2!`U!h1?Ii!@!427!P#42:#A!'%D2)!
+262()&!:-2!&/42+.#&:#A!2FF2A:!%F!>BR!EB!(4D!@B&#:2&!%4!K;!+#$%&%'()!
F+('2&-#F:#4.0!CMA)2#A!@A#D&!"2&2(+A-!GNc!1N;8B1N180!
1?Q0!E)(4:!>ER!"(P(M&P(#:2!"R!9(/)%+!Z"R!Z#4'(4!gZ!h1?;?i!@A-#26#4.!(!W%)D24!
*2(4c!*2A-(4#&'&!$/!O-#A-!S%+%4(6#+M&2&!>4&M+2!L/4:-2&#&!%F!:-2!
S%+2A:!L:%#A-#%'2:+#A!"(:#%&!%F!a#+()!E+%:2#4&0!g%M+4()!%F!a#+%)%./0!
1?I0!X2F2+&!UR!`[2'&!gR!5&:2+.(+D!XR!X(+&24!CR!W(+2:!"@!h;8IQi!>6%)M:#%4(+/!
+2)(:#%4&-#,&!('%4.&:!(+A-(2$(A:2+#(0!@!A%',(+(:#62!&:MD/!%F!1G!L!
+#$%&%'()!"C@&!%F!(!&M),-M+BD2,24D24:!2Y:+2'2!:-2+'%,-#)2R!(4!
2Y:+2'2!-()%,-#)2!(4D!(!:-2+'%,-#)#A!'2:-(4%.240!g%M+4()!%F!*%)2AM)(+!
3#%)%./!;8<c!HGBN;0!
1?80!E2:+%6!@CR!*2&P(M&P(&!@R!"%&-7()$!LSR!Z#4'(4!gZ!h1?Ii!^2(&:!+#$%&%'()!
,+%:2#4!X;?!-2),&!A%+D#4(:2!:"C@!'%62'24:!:-+%M.-!:-2!)(+.2!&M$M4#:0!
CMA)2#A!@A#D&!"2&2(+A-!GN!N;IQBN;8I0!
1;?0!"(P(M&P(#:2!"R!Z#4'(4!gZ!h1?Ii!+"C@!'M:(4:&!#4!:-2!/2(&:!
,2,:#D/):+(4&F2+(&2!A24:2+!+262()!()%&:2+#A!#4F%+'(:#%4!42:7%+P&!(4D!
'2A-(4#&'&!%F!D+M.!+2&#&:(4A20!CMA)2#A!@A#D&!"2&2(+A-!GNc!;H8QB;<?Q0!
 
 
177 
1;0!3MDP26#A-!9aR!>)m&P(/(!@aR!C#2+-(M&!`U!h1?Ii!J2(:M+2&!%F!I?L!
'(''()#(4!+#$%&%'2!(4D!#:&!&M$M4#:&0!CMA)2#A!@A#D&!"2&2(+A-!GNc!HQGNB
HQHH0!
1;10!Z#4%&!WR!`(),(Y#&!ZXR!O#)&%4!ZCR!C#2+-(M&!`U!h1?<i!Z2(A/)(:2D!:"C@!#&!
+2)2(&2D!F+%'!:-2!>!&#:2!M,%4!@!&#:2!%AM,(:#%4!$M:!$2F%+2!W9E!#&!
-/D+%)/V2D!$/!>JB9M0!CMA)2#A!@A#D&!"2&2(+A-!Gc!<18;B<18N0!
1;G0!"-%D#4!*UgR!Z#4'(4!gZ!h1?;?i!@!F)2Y#$)2!)%,!#4!/2(&:!+#$%&%'()!,+%:2#4!
X;;!A%%+D#4(:2&!EB&#:2!:"C@!$#4D#4.0!CMA)2#A!@A#D&!"2&2(+A-!GIc!IGQB
IGI80!
1;H0!L-(&'()!*R!S-(P+($%+:/!3R!L24.M,:(!g!h1?;?i!=4:+#4&#A!'%)2AM)(+!,+%,2+:#2&!
%F!:-2!,+%:2#4B,+%:2#4!$+#D.2!F(A#)#:(:2!+(:A-2:B)#P2!'%:#%4!%F!:-2!
+#$%&%'20!3#%A-2'#A()!(4D!3#%,-/&#A()!"2&2(+A-!S%''M4#A(:#%4&!G8c!
;81B;8Q0!
1;<0!S'2[)(!"R!S'2[)%6(!gR!U(4D+P%6(!UR!E2:+(P!gR!E2:+:/)%6(!`R!2:!()0!h1?8i!
=D24:#F#A(:#%4!%F!'M:(:#%4&!#4!:-2!+#$%&%'()!,+%:2#4!X<!h"EX<i!(4D!
+#$%&%'()!,+%:2#4!X;!h"EX;i!.242&!#4!SV2A-!,(:#24:&!7#:-!Z#('%4DB
3)(APF(4!(42'#(0!UM'(4!*M:(:#%4!g%M+4()!G?c!G1;BG1Q0!
1;N0!bM(+2)%!ER!W(+2)#!>R!S(+(4D%!@R!3+M&A%!@R!S()($+2&2!"R!2:!()0!h1?;?i!
Z#('%4DB3)(APF(4!(42'#(c!.24%:/,2B,-24%:/,2!A%++2)(:#%4&!#4!=:()#(4!
,(:#24:&!7#:-!"EX<!(4D!"EX;!'M:(:#%4&0!U(2'(:%)%.#A(!8<c!1?NB1;G0!
1;Q0!Z(#!*LR!L-#!ZR!g#4!^R!LM4!]R!_-(4.!^R!2:!()0!h1??Ni!"2.M)(:#%4!%F!:-2!*Z*1B
,<G!,(:-7(/!$/!+#$%&%'()!,+%:2#4!X;!#46%)62&!(!,%&:BM$#lM#:#4(:#%4!
'2A-(4#&'0!g%M+4()!%F!3#%)%.#A()!S-2'#&:+/!1I;c!1HG?HB1HG;G0!
1;I0!Z(#!*LR!LM4!]R!XM!U!h1?;?i!"#$%&%'()!,+%:2#4!X;!(&%A#(:2&!7#:-!AB*/A!
(:!<!L!+"C@!(4D!:"C@!.242&!(4D!+2.M)(:2&!:-2#+!2Y,+2&#%40!g%M+4()!%F!
3#%)%.#A()!S-2'#&:+/!1I<c!;1<IQB;1<8H0!
1;80!LM4!]R!O(4.!^WR!]#+%D#'(&!ZER!Z(#!*L!h1?;?i!E2+:M+$(:#%4!%F!N?!L!
+#$%&%'()!$#%.242&#&!+2&M):&!#4!+#$%&%'()!,+%:2#4!X<B!(4D!X;BD2,24D24:!
,<G!(A:#6(:#%40!g%M+4()!%F!3#%)%.#A()!S-2'#&:+/!1I<c!1<I;1B1<I1;0!
11?0!5-:(P2!^R!O#AP42+!"3!h;88<i!^2(&:!6#+M&!,+%,(.(:#%4!D2,24D&!A+#:#A()/!%4!
F+2!N?L!+#$%&%'()!&M$M4#:!A%4A24:+(:#%40!*%)2AM)(+!j!S2)M)(+!3#%)%./!
;<c!1QQ1B1QI;0!
1;0!*2&P(M&P(&!@R!Z#4'(4!gZ!h1?Ii!"#$%&%'()!,+%:2#4!XG!FM4A:#%4&!(&!(!
m+%AP2+!&7#:A-m!:%!(#D!#4!A%%+D#4(:#4.!%F!)(+.2!&M$M4#:B(&&%A#(:2D!
FM4A:#%4&!#4!2MP(+/%:2&!(4D!@+A-(2(0!CMA)2#A!@A#D&!"2&2(+A-!GN!!!N;Q<B
N;IN0!
110!`#,(+#&%6!LR!E2:+%6!@R!*2&P(M&P(&!@R!L2+.#26!EaR!Z%4:&%6(!5@R!2:!()0!h1?<i!
L:+MA:M+()!(4D!FM4A:#%4()!(4()/&#&!%F!<L!+"C@!#4!L(A-(+%'/A2&!
A2+26#&#(20!*%)2AM)(+!W242:#A&!(4D!W24%'#A&!1QHc!1G<B1HQ0!
11G0!32&2%6(!=R!"2$)%6(!`R!X2%4:#&!C3R!L,%42+!g!h1?;?i!*%)2AM)(+!D/4('#A&!
&#'M)(:#%4&!&M.2&:!:-(:!"C@!:-+2B7(/![M4A:#%4&!A(4!(A:!(&!F)2Y#$)2!"C@!
&:+MA:M+()!2)2'24:&!#4!:-2!+#$%&%'20!CMA)2#A!@A#D&!"2&2(+A-0!
1H0!Z#4'(4!gZ!h1?<i!<L!+"C@c!L:+MA:M+2!(4D!JM4A:#%4!F+%'!U2(D!:%!9%20!
=4:2+4(:#%4()!g%M+4()!%F!3#%'2D#A()!LA#24A2!;c!1BQ0!
1<0!*2&P(M&P(&!@R!Z#4'(4!gZ!h1?Qi!"#$%&%'()!,+%:2#4!XGc!W(:2P2,2+!:%!:-2!
@B&#:20!*%))2AM)(+!S2))!1<c!IQQBIII0!
 
 
178 
1N0!C(+#(#!*R!9(4(P(!9R!5P(D(!9R!L-#+(#!SR!U%+#.%'2!SR!2:!()0!h1?<i!L/42+.#&:#A!
D2F2A:!#4!N?L!+#$%&%'()!&M$M4#:!(&2'$)/!A(M&2D!$/!(!'M:(:#%4!%F!"+&;,R!
(!+#$%&%'()!,+%:2#4!X;B$#4D#4.!,+%:2#4R!(4D!GmB2Y:24&#%4!%F!<L!+"C@!#4!
L(A-(+%'/A2&!A2+26#&#(20!CMA)2#A!@A#D&!"2&2(+A-!Gc!H<GBH<N10!
11Q0!O%)F2!`UR!L-#2)D&!ZS!h;88Qi!*%)2AM)(+!26#D24A2!F%+!(4!(4A#24:!DM,)#A(:#%4!
%F!:-2!24:#+2!/2(&:!.24%'20!C(:M+2!GIQc!Q?IBQ;G0!
11I0!`2))#&!*R!3#++24!3OR!X(4D2+!>L!h1??Hi!E+%%F!(4D!26%)M:#%4(+/!(4()/&#&!%F!
(4A#24:!.24%'2!DM,)#A(:#%4!#4!:-2!/2(&:!L(A-(+%'/A2&!A2+26#&#(20!
C(:M+2!H1Ic!N;QBN1H0!
180!L:2+4!LR!*%(V2D!ZR!C%)2+!UJ!h;8Ii!L:+MA:M+()!(4()/&#&!%F!"C@!M&#4.!
A-2'#A()!(4D!24V/'(:#A!,+%$#4.!'%4#:%+2D!$/!,+#'2+!2Y:24&#%40!
*2:-%D&!>4V/'%)%./!;NHc!HI;BHI80!
1G?0!"-%D#4!*UgR!Z#4'(4!gZ!hLM$'#:2Di!=D24:#F#A(:#%4!%F!(4!>Y:24&#62!C2:7%+P!
%F!=4F%+'(:#%4!J)%7!:-+%M.-!:-2!3;$TA!=4:2+&M$M4#:!3+#D.2!%F!:-2!^2(&:!
"#$%&%'20!
1G;0!Z#4'(4!gZ!h1?Ni!E+%.+(''2D!"#$%&%'()!J+('2&-#F:#4.!W%2&!32/%4D!
a#+M&2&c!5+.(4#&'&!F+%'!()!:-+2!P#4.D%'&!M&2!F+('2&-#F:#4.!:%!+2.M)(:2!
.242!2Y,+2&&#%4R!,2+-(,&!&#.4()#4.!(!,(+(D#.'!&-#F:0!*#A+%$2!
hO(&-#4.:%4!ZSi!;c!<1;B<1Q0!
1G10!_(4A-#4!C=R!"%$2+:&!ER!Z2L#)6(!@R!L-2+'(4!JR!W%)DF(+$!ZL!h;8Qi!
L(A-(+%'/A2&!A2+26#&#(2!C#,Q,!#&!+2lM#+2D!F%+!2F#A#24:!N?L!+#$%&%'2!
&M$M4#:!$#%.242&#&0!*%)2AM)(+!j!S2))M)(+!3#%)%./!;Qc!<??;B<?;<0!
1G0!@AP2+!*WR!L-#4!3LR!C(4D(!gLR!L(#4#!@`R!Z262+!9>R!2:!()0!h1?8i!`#42:#A!
(4()/&#&!%F!)(:2!&:2,&!%F!2MP(+/%:#A!:+(4&)(:#%4!#4#:#(:#%40!g%M+4()!%F!
*%)2AM)(+!3#%)%./!GI<c!H8;B<?N0!
1GH0!"%))B*2A(P!@R!S(%!SR!Z262+!9>R!3M+)2/!L`!h1??i!]B"(/!&:+MA:M+2&!%F!:-2!
M4#62+&()!:+(4&)(:#%4!#4#:#(:#%4!F(A:%+!=J1T2=J<3c!A%4F%+'(:#%4()!A-(4.2&!
%4!WZE!(4D!W9E!$#4D#4.0!S2))!;?Gc!QI;BQ810!
1G<0!W+/P!*"R!*(+#4:A-26!@R!*(A#2[27&P#!*OR!"%$2+:&%4!@R!O#)&%4!LUR!2:!()0!
h1?1i!*(,#4.!%F!:-2!#4:2+(A:#%4!#4:2+F(A2!%F!ZC@!,%)/'2+(&2!$2:(!7#:-!
]"SS;0!L:+MA:M+2!;?c!;Q?8B;Q1?0!
)