ARTICLE
https://doi.org/10.1038/s41467-022-28587-z OPEN
Cytonemes coordinate asymmetric signaling and
organization in the Drosophila muscle progenitor
niche
Akshay Patel 1, Yicong Wu 2, Xiaofei Han2, Yijun Su2,3, Tim Maugel 4, Hari Shroff2,3 & Sougata Roy 1?
Asymmetric signaling and organization in the stem-cell niche determine stem-cell fates.
Here, we investigate the basis of asymmetric signaling and stem-cell organization using the
Drosophila wing-disc that creates an adult muscle progenitor (AMP) niche. We show that
AMPs extend polarized cytonemes to contact the disc epithelial junctions and adhere
themselves to the disc/niche. Niche-adhering cytonemes localize FGF-receptor to selectively
adhere to the FGF-producing disc and receive FGFs in a contact-dependent manner. Acti-
vation of FGF signaling in AMPs, in turn, reinforces disc-specific cytoneme polarity/adhesion,
which maintains their disc-proximal positions. Loss of cytoneme-mediated adhesion pro-
motes AMPs to lose niche occupancy and FGF signaling, occupy a disc-distal position, and
acquire morphological hallmarks of differentiation. Niche-specific AMP organization and
diversification patterns are determined by localized expression and presentation patterns of
two different FGFs in the wing-disc and their polarized target-specific distribution through
niche-adhering cytonemes. Thus, cytonemes are essential for asymmetric signaling and
niche-specific AMP organization.
1 Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD, USA. 2 Laboratory of High-Resolution Optical Imaging,
National Institute of Biomedical Imaging and Bioengineering, National Institutes of Health, Bethesda, MD, USA. 3 Advanced Imaging and Microscopy
Resource, National Institutes of Health, Bethesda, MD, USA. 4Department of Biology, Laboratory for Biological Ultrastructure, University of Maryland, College
Park, MD, USA. ?email: sougata@umd.edu
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 1
1234567890():,;
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
T issue development and homeostasis rely on the ability of In this study, we show that cytonemes are required to generatestem cells to maintain a balance between self-renewal and asymmetric signaling and AMP organization within the wing discdifferentiation. Stem cell fate decisions are made in the niche. Investigation into the underlying mechanisms revealed that
context of the niche that they adhere to and are controlled by cytonemes integrate two essential cell organizing functions niche-
asymmetric signaling and the physical organization in the stem specific adherence and fibroblast growth factor (FGF) signaling.
cell microenvironment1?9. Asymmetric signaling maintains stem AMPs extend FGFR-containing cytonemes to identify and adhere
cell identity in niche-resident stem cells but promotes differ- to an FGF-producing wing disc niche. Niche-adhering AMP
entiation of their daughters outside the niche in an organized cytonemes also directly receive FGFs from the niche, and the
pattern. Physical organization and interactions between stem and activation of FGF signaling in AMPs, in turn, reinforces the
supporting cells also control stem cell niche-occupancy and niche-specific polarity and adherence of cytonemes. We showed
asymmetric signaling1,10. Understanding how asymmetric sig- that this interdependence between the cause and effect of
naling and cellular organization arise and are coordinated within cytoneme-mediated interactions produces and maintains diverse
the stem cell microenvironment is critical to understand how niche-specific asymmetric AMP organizations. Furthermore, we
stem cells maintain their identity and prime differentiation in an showed that the cytoneme-dependent AMP organization is
organized pattern to generate tissues. modulated by the extrinsic compartmentalized expression and
Niche cells are known to present self-renewal growth factors to presentation patterns of two different FGFs in the wing disc, and
the stem cells in an asymmetric manner11,12. Although these by their polarized, target-specific distributions to the niche-
secreted signals can act over a long-range and are predicted to adhering AMPs through cytonemes. These findings provide
disperse randomly in the extracellular environment, their activ- insights into how cytoneme-mediated polarized signaling can
ities are spatially confined to the niche. Moreover, signals are play critical roles in generating and maintaining diverse niche-
selectively delivered only to the stem cells, but not to their specific asymmetric stem cell organizations.
neighboring non-stem cell daughters, often located one cell dia-
meter away11,12. Elegant experiments using cultured embryonic
stem cells (ESC) have shown that asymmetric stem cell division Results
requires localized target-specific signal presentation13. For AMP polarity changes with increasing distance from the wing
instance, while the spatially restricted presentation of bead- disc niche. The Drosophila larval wing imaginal disc serves as the
immobilized Wnt induces asymmetric signaling and ESC divi- niche for AMPs, the adult flight muscles progenitors, and the air-
sion, the presentation of soluble Wnt and global activation of sac primordium (ASP), the precursor for the adult air-sac that
signaling in ESC sustains only symmetrical division13. These supplies oxygen to flight muscles30,38 (Fig. 1A). AMPs are asso-
findings suggested that the localized and directed signal pre- ciated with the basal surfaces of disc and ASP epithelia
sentation and interpretation might form the basis of the asym- (Fig. 1A?)39. In the 3rd instar larval discs, AMPs asymmetrically
metry within the stem cell niche. divide by orienting their division axes in oblique-to-orthogonal
An in vivo mechanism for localized and directed distribution direction relative to the disc epithelium and produce a multi-
of signals during animal development came from the discovery of stratified layer orthogonal to the disc epithelial plane30. To gain
specialized signaling filopodia, called cytonemes14?16. Studies in insights into the cellular organization of the AMP niche, we
developing Drosophila and vertebrate embryos demonstrated that examined 3rd instar larval wing discs using transmission electron
signal-exchanging cells extend cytonemes to contact each other microscopy (TEM) and confocal microscopy. TEM analyses of 16
and exchange signaling proteins at their contact sites14,15,17?22. wing disc sections (from w1118 larvae) revealed that AMPs are
Cytonemes have been implicated in all major signaling asymmetrically organized orthogonally over the disc within a
pathways23?25. Cytonemes or cytoneme-like signaling projections space between the basal surface of disc cells and the disc basal
such as MT-nanotubes are known to be required in Drosophila lamina (Fig. 1A?D).
germline stem cells niches12,26,27 and stem-cell-derived synthetic AMPs had polarized elliptical shapes; however, their orienta-
organoids28. These previous observations raise the possibility that tions changed with a change in the AMP location along the
contact-dependent signaling through cytonemes could form the proximo (p)-distal (d) orthogonal axis relative to the disc plane
basis of asymmetric signaling and cellular organization in stem (Fig. 1A?D). While the disc-proximal AMPs (p) had their major
cell niches. However, much needs to be learned about the roles axis oriented in the oblique-to-orthogonal direction relative to the
and mechanisms of cytonemes in establishing functional asym- disc plane, the disc-distal AMPs (d) had their major axes aligned
metry in the stem cell niche. parallel to the disc plane (Fig. 1B, C). Moreover, the membrane of
To address this question, we selected the Drosophila wing disc- proximal AMPs established direct contact with the disc and often
associated adult muscle precursors (AMPs), which constitute a extended many cytoneme-like filopodia37 that protruded into the
well-characterized population of stem cells maintained within the disc cell membrane or the intercellular space (Fig. 1D and
wing disc niche29,30. AMPs are embryonic in origin and are Supplementary Fig. 1A, A?). In contrast, disc-distal AMPs (d)
associated with the larval wing disc to proliferate and produce a lacked such direct physical contacts with the disc (Fig. 1B, C).
pool of transient amplifying cells that undergo myogenic fusions These results indicated that the positioning of individual AMPs
and differentiation during metamorphosis to form adult flight within the wing disc niche might be linked to their polarity and
muscles29,31?34. The wing imaginal disc produces several self- contact-dependent interactions with the disc.
renewal signals for AMPs30,34,35. Disc-derived Wingless (Wg) To quantitatively assess the correlation between AMP polarity
and Serrate (Ser) control asymmetric AMP divisions, which retain and positioning, we labeled AMP nuclei with nls:GFP (nuclear-
mitotically active AMPs at the disc-proximal space and place localized GFP expressed under the AMP-specific htl-Gal4 driver),
their daughters at a disc-distal location to commit to post-mitotic and used confocal microscopy to record nuclear position and
fates30. AMPs are also known to employ cytonemes to mediate orientation in three dimensions, relative to the actin-rich disc-
Notch and Wingless/Wg (Wnt) signaling with the disc-associated AMP interface (phalloidin-marked) (Fig. 1A, E?F?). To examine
trachea and wing discs, respectively36,37. These prior character- how nuclear polarity changed with increasing distance from the
izations and the availability of genetic tools and imaging methods disc, we measured the angle between the wing disc plane and the
provide an ideal system to examine the roles of cytonemes in major axis of each elliptical nucleus positioned at various
generating functional asymmetry in the wing disc AMP niche. distances away from the disc (Fig. 1G and Supplementary
2 NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
Fig. 1 Correlation of the AMP position and polarity relative to the disc. A Drawing of an L3 wing disc showing the spatial organization of AMPs, wing disc
notum and hinge areas, and ASP (air-sac primordium) and TC (transverse connective); dashed box (left), ROI used for all subsequent YZ cross-sectional
images. B?D TEM sections of wing disc (w1118) showing YZ views of different wing disc notum areas; double-sided dashed arrows, long axes of elliptical
AMPs; p-d dashed arrow, proximo (p)-distal (d) axis relative to the disc plane (dashed line); white arrow, cytoneme-like disc-invading projections from
AMPs (D see Supplementary Fig. 1A,A?); BM basement membrane. E?E? Spatial organization of nls:GFP-marked AMP nuclei, orthogonal to the wing disc
notum (E, E?) and hinge (E, E?) as illustrated in A. F?H Cross-sections of wing disc regions (indicated in ROI box in A) harboring nls:GFP-marked AMPs;
double-sided arrows, nuclear orientation; F? green channel of F; dashed and solid arrows, distal and proximal layer cells, respectively; G drawing illustrating
the strategy to measure nuclear orientation as angles (Theta, ?) between AMP nuclei and the disc plane; H graph showing quantitative analyses of AMP
nuclear orientation at different disc-relative locations; p: proximal (125 nuclei), d: distal (58 nuclei), p?1: one layer above p (119 nuclei), d?1: one layer below
d (84 nuclei); also see Supplementary Table 1 and see ?Methods? section for statistics; source data are provided as a ?Source Data? file. I?K Single XY
optical sections of the discs, showing diverse morphologies of distal AMPs; dashed arrows, elongated syncytial cells; arrowhead, small nonpolar cells (also
see Supplementary Fig. 1B?D?). E, F? red, phalloidin, marking tissue outlines (also indicated by dashed line). Genotype: UAS-nls:GFP/+; htl-Gal4/+ (E?K).
Scale bars: 20 ?m; 10 ?m (B, C, K); 5 ?m (D).
Table 1). With these analyses, we confirmed that disc-proximal In addition, as nls:GFP labeled both the nucleus and cytoplasm,
AMP nuclei were polarized toward the disc, and disc-distal nuclei these experiments also revealed diverse morphological features of
had their axes aligned parallel to the disc plane. Moreover, the distal AMPs (Fig. 1I?K and Supplementary Fig. 1B?D?). A
polarity of AMP nuclei gradually changed with increased population of htl expressing distal cells had small non-polar
orthogonal distances from the disc (Fig. 1E?H and Supplemen- spherical (diameter ~2?5 ?m) shapes (Fig. 1K). Another group of
tary Table 1). AMPs had highly elongated multi-nucleated (2?3 nuclei/cell)
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 3
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
syncytial morphology, which is a hallmark of myogenic fusion40 Despite the regular turnover, the overall cytoneme density (niche
(Fig. 1I, J and Supplementary Fig. 1B?D?). Notably, AMPs with occupancy) within the disc area remained uniform over time
diverse morphologies were predominantly enriched proximal to (Fig. 2I and Supplementary Movie 4). These results suggested that
the transverse connective (TC) and ASP and often adhered to the the AMPs are dynamically adhered to the disc via cytonemes, and
TC/ASP surfaces (Supplementary Fig. 1C). It is possible that the that this dynamism might enable multiple proximal AMPs to
disc-associated tracheal epithelium acts as a second niche to share the limited niche space.
support disc-distal AMPs, but, here, we focus only on the disc-
AMP interactions. AMP cytonemes anchor AMPs to the disc adherens junction.
To characterize the cytoneme?disc interactions, we simulta-
neously expressed CD2:GFP in AMPs under htl-LexA and
Disc-specific AMP polarity and positioning are linked to disc- nls:mCherry in the disc notum under ths-Gal4 control. For deep
adhering AMP cytonemes. The appearance of diverse morphol- tissue imaging of cytonemes (50?80 ?m deep from the objective),
ogies in disc-distal AMPs is consistent with the post-mitotic fates
30,38 we employed a triple-view line-confocal imaging method, whichof the distal AMPs, as reported before . Therefore, we hypo- enabled ~2-fold improvement in axial resolution (Fig. 3A?D?)42.
thesized that the disc-specific AMP polarity and adherence Orthogonal cytonemes were found to emanate in a polarized
maintain disc-proximal positional identity and stemness of manner from only the ventral surface of disc-proximal AMPs and
AMPs, and that the loss of disc-specific polarity and adhesion invade through the intercellular space of the disc epithelium
enables AMPs to acquire disc-distal positions and morphologic (Fig. 3C-D?? and Supplementary Movie 5). Analyses of XY and
features required for fusion/differentiation. To test this model, we XZ optical sections revealed that multiple AMP cytonemes shared
generated a transgenic fly harboring a htl>FRT-stop-FRT>Gal4 a common disc intercellular space and they grew toward apical
construct that can induce random fluorescently marked FLIP-out junctions of the disc epithelium (Fig. 3D-D?).
clones exclusively in the AMP layers (Fig. 2A, see ?Methods? To examine if AMP cytonemes are tethered to the intercellular
section). Generation of sparsely located single-cell AMP clones, disc space, we expressed mCherryCAAX in disc cells and
marked with either membrane-localized CD8:GFP or actin- CD2:GFP in AMPs and imaged these tissues with an Airyscan
binding Lifeact:GFP, allowed us to compare the morphologic confocal microscope. We also immunoprobed these tissues for
features of AMPs present at different locations within the same various sub-apical adherens junction markers, including Discs-
tissue (Fig. 2B?B? and Supplementary Fig. 1E, F). large protein, beta-catenin (Armadillo), and DE-Cadherin. As
Confocal YZ sections of discs revealed that disc-proximal shown in Fig. 3E?J (Supplementary Movies 6 and 7), long AMP
AMPs (single cell clones) were oriented toward the disc, and they cytonemes extended through the basolateral intercellular space of
also projected long orthogonally-polarized cytonemes toward the the wing disc cells and appeared to contact the sub-apical
disc that apparently invaded into the disc epithelium (~2?3/cell; adherens junction. Cytoneme tips were often helically twisted
~12?15 ?m long; Fig. 2B-B? and Supplementary Table 2). In around the junctional membrane components (Fig. 3J), poten-
contrast, the disc-distal AMP clones had both polar and non- tially to increase the surface area of the contacts.
polar shapes and they appeared to adhere to each other, often To examine if AMP cytonemes selectively contact the apical
forming syncytial morphologies (Fig. 2B? and Supplementary disc junctions, we used the synaptobrevin-GRASP, a trans-
Fig. 1G-G?). Importantly, the polarized disc-distal AMPs had synaptic GFP complementation technique20,43. When we
their axes aligned in parallel to the disc plane, as observed before, expressed CD4:GFP11 on the wing-disc cell membrane and
and although they extended laterally oriented cytonemes (av. ~6/ mCherryCAAX and syb:CD4:GFP1?10 in AMPs, high levels of
cell) toward each other and the TC/ASP, they lacked orthogonal GFP reconstitution occurred selectively at the contact sites
cytonemes (Fig. 2B?B? and Supplementary Table 2). Notably, between the tips of the cytonemes and the actin-rich (phalloi-
despite having morphologic hallmarks of AMP?AMP adhesion/ din-marked) disc apical junctions. Thus, AMP cytonemes
fusion, distal AMPs (except for non-polar AMPs) still retained a establish direct contact with the disc adherens junctions (Fig. 3K,
promyogenic transcriptional state based on the expression of the
41 K?). It is important to note that although these experiments weretranscription factor Twist (Twi) (Supplementary Fig. 1H-H?) . performed using a disc-specific ths-Gal4 driver, contacts between
These observations were consistent with the model that the loss of cytonemes and disc junction were recorded even in disc areas that
disc-specific polarity and adhesion primes AMPs to prepare for did not express ths-Gal4 (Fig. 3H, H?). Thus, AMPs employ
myogenic fusion. cytonemes to occupy the wing disc niche and this cytoneme-
The presence of orthogonally polarized disc-invading cyto- mediated occupancy is likely to be a general mechanism for
nemes exclusively in the disc-proximal AMPs suggested that these AMP-niche adhesive interactions.
cytonemes might be involved in physically adhering/holding
AMPs to the disc-proximal position and establishing their disc-
specific polarity. Orthogonal AMP cytonemes appeared to be Cytoneme-disc contacts predict AMP position and polarity
stable structures as they were detected in comparable numbers relative to the disc. If cytoneme-mediated adhesion is required to
under both fixed and live conditions and irrespective of the specify disc-specific AMP polarity, disc-proximal location, and
genetic markers or drives used (Fig. 2C?E). Moreover, wing disc stemness, removal of cytonemes might induce the loss of these
cells were also observed to extend short actin-rich projections, features and gain of distal positioning and differentiation. The
probably to promote AMP-disc physical interactions (Fig. 2F). Drosophila Formin Diaphanous (Dia) is a known cytoneme
Further characterization of AMP cytonemes revealed that they modulator of actin-based cytonemes15,36. We found that AMP
are primarily composed of actin. AMP cytonemes were enriched cytonemes localized Dia:GFP and a constitutively active Dia-
with actin-binding phalloidin and Lifeact:GFP, but they lacked act:GFP (Fig. 4A, B). Moreover, compared to control discs, dia
microtubule marker, such as EB1:GFP (Fig. 2C?, D and knockdown in Lifeact:GFP-marked AMPs significantly reduced
Supplementary Fig. 2A,A?). Live imaging of CD2:GFP-marked AMP cytoneme numbers (Fig. 4C, D). Therefore, to record the
AMPs in ex-vivo cultured wing discs, revealed that the orthogonal effects of cytoneme loss in AMPs, we genetically removed AMP
cytonemes dynamically extend and retract at an average rate of ~ cytonemes by knocking down dia from AMPs.
1 ?m/min and have an average life-time of ~25 min (Fig. 2G?J When dia-i was expressed in either Lifeact:GFP-marked
and Supplementary Fig. 2C, D and Supplementary Movies 1?3). (detects morphology) or nls:GFP-marked (detects nuclear
4 NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
Fig. 2 Disc-specific AMP polarity and adhesion are linked to polarized AMP cytonemes. A Schematic depiction of htl>FRT>stop>FRT>Gal4 construct and
its application to generate FLIP-out clones exclusively in AMPs (also see Supplementary Fig. 1E, F). B-B? Wing disc harboring random CD8:GFP-marked
AMP clones (hs-Flp; UAS-CD8:GFP; htl>FRT>stop>FRT>Gal4) showing orthogonal and lateral polarity of AMPs and AMP cytonemes relative to disc plane;
arrow and dashed arrow, proximal and distal AMPs/AMP cytonemes, respectively; arrowhead, distal small non-polar cells; *, adherent distal AMPs;
phalloidin (red), actin-rich disc-AMP junction and cell-cortex (also see Supplementary Fig. 1G?H?); B? GFP channel of B; B?? Violin plots showing angles
(Theta, ?; see Fig. 1G) between proximal and distal AMPs and their cytonemes relative to their underlying disc plane (see Supplementary Table 2 for
statistical analyses). C?E Comparison of AMP cytonemes (arrows) marked by various fluorescent proteins driven by different transcription drivers, in fixed
and live tissues, as indicated; arrowhead, actin-rich (phalloidin-marked) apical-junction of disc epithelium; E Graphs comparing length and numbers
(count/100 ?m length of AMP-disc interface) of orthogonal cytonemes (n= >125 cytonemes for each genotype/condition, imaged from >5 wing disc/
genotype under fixed condition and four discs under live condition; see ?Source Data? for statistics). F Actin-rich cytonemes (arrow) from wing disc cells
expressing mCherryCAAX and Lifeact:GFP (fixed tissue). G?J Live dynamics of AMP cytonemes; G 3D-rendered image showing live cytonemes captured
from p-to-d direction of the tissue; H dynamics of cytonemes (arrow) (2 min time-lapse, also see Supplementary Movies 1?4); I Graphs showing numbers
of niche-occupying cytonemes over time within selected ROIs; three graph colors, three discs; J Graph showing the distribution of cytonemes lifetimes
(n= 77 cytonemes; also see Supplementary Fig. 2D). Source data for B??, I, and J are provided as a ?Source Data? file. C?J Genetic crosses: enhancer-Gal4/-
LexA x UAS-/LexO-fluorescent protein (FP), as indicated. Scale bars: 20 ?m; 5 ?m (H).
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 5
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
htl-LexA>CD2:GFP  ths-Gal4>nls-mCherry
htl
CRE C C?
LexA X1
LexO
htl-LexA
* *z
A x y
ths-Gal4
ths
CRE Gal4 X2 D D? D? D??
UAS AMP
Basal
OBJ-1  OBJ-2
XY section 
B 1xPBS wing disc (D?,F)
Glass bottom chamber Septate junction
y
emission AdherensOBJ-3 Apical junction
excitation x
htl-LexA>CD2:GFP  ths-Gal4>mCherryCAAX ?Dlg
E E? E?? F G H H?
y
x
I I? J K K?
*
*
*
Fig. 3 AMP cytonemes anchor AMPs to the wing disc adherens junctions. A, B Schematic depictions of the genetic strategy (A) used to simultaneously
mark AMPs and the disc notum, and imaging strategy (B) using multi-view microscopy for deep-tissue imaging. C, D?? Triple-view confocal imaging
showing CD2:GFP-marked orthogonally polarized cytonemes (arrow) emanating from disc-proximal AMPs (*, in C?) and invading through the intercellular
space between nls:mCherry-marked disc cells (C, D, D?); D?-D?? single XY cross-sections of disc, as illustrated in D??, showing multiple cytonemes sharing
the same intercellular space. E?H? CD2:GFP-marked AMP cytonemes at the intercellular space of mCherryCAAX-marked wing discs approaching apical
adherens junctions (Dlg stain, blue); E?, E?, dashed box area in E; F XY cross-section of disc showing niche sharing by multiple cytonemes; G Airyscan
image of cytoneme tip approaching adherens junction (arrowhead), H, H? AMP cytonemes (arrow) in both ths-Gal4 expressing (red) and non-expressing
areas (dashed line). I, J Tip regions of AMP cytonemes contacting disc adherence junction that is marked with DCAD2 (I, I?) and Arm (J); *, helical twists
in cytonemes; arrowhead, contact sites; I? zoomed-in image from ROI in I. K, K? Synaptic cytoneme-disc contact sites mapped by syb-GRASP (see
?Methods? section) between sybGFP1?10- and mCherryCAAX-expressing AMP cytonemes and the actin-rich (phalloidin, blue) apical junction of
CD4:GFP11-expressing wing-disc cells. All images are YZ cross sections unless noted. All panels, Gal4/UAS or LexA/LexO or genetic combinations of both
used, as indicated (see Methods). Scale bars: 20 ?m; 5 ?m (E, E?, I?, F, G); 2 ?m (J).
polarity and number) AMPs under htl-Gal4 control, the (Fig. 4F?G?, I, I?). Since Lifeact:GFP was expressed only in AMPs,
polarized, multi-stratified AMP organization was lost with a a multi-nucleated syncytium lined by a common Lifeact:GFP-
concomitant gain of fusogenic responses in AMPs (Fig. 4E?I? and marked membrane cortex indicated the fusion of multiple AMPs
Supplementary Table 1). The mutant AMPs were apparently to form the giant chambers.
induced to adhere and fuse to each other to form large syncytial Although mutant AMP nuclei localized the promyogenic
assemblies (Fig. 4F). Optical-sections through these giant transcription factor Twist (twi), AMP fusion and syncytial
chambers revealed that each one of them was lined by a common myotube-like formation is a morphological hallmark of AMP
thick actin-rich membrane cortex (marked with phalloidin or differentiation40. Notably, AMP fusion is a multistep process,
Lifeact:GFP) housing multiple large-sized nuclei (probed with which can be stalled at an intermediate step44. Based on the
nls:GFP expression, DAPI, and Twist immunostaining) Fig. 4G, G?, the dia-i induced AMP fusion apparently was stalled
6 NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
htl-Gal4>Lifeact:GFP ?DCAD2
?Arm htl-LexA>CD2:GFP
htl-LexA>sybGFP1-10, mCherryCAAX
ths-Gal4>CD4:GFP11 Phalloidin
Wing disc
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
A Dia:GFP B Diaact:GFP C Control D dia-i
mCherryCAAX
Control dia-i
E F G G?
*
* * * * *
* *
*
*
y y
twi
x x DAPI DAPI
Control dia-i
H H? I I?
d
ASP
*
y z p y z * *
x y x y
J K d
L z
p p y
y z L?
z
x d y x
J? K? M N O O?
z d z y
y x x
Fig. 4 Disc-cytoneme adhesion determines AMP position and fates. A?D AMP cytoneme formation depends on Dia; A, B mCherryCAAX-marked AMP
cytonemes localizing Dia:GFP (A UAS-mCherryCAAX/UAS-Dia:GFP; htl-Gal4/+) and Diaact:GFP (B hsflp/+; UAS-mCherryCAAX/+; htl>FRT>stop>FRT>Gal4/
UAS-Diaact:GFP). C, D Loss of cytonemes (arrow) in Lifeact:GFP-marked AMPs expressing dia-i; average numbers of orthogonal cytonemes/100 ?m of AMP-
disc interface (? standard deviation (SD)): control (htl-Gal4>Lifeact:GFP)= 36.9 ? 3.8, and dia-i condition (htl-Gal4>Lifeact:GFP; dia-i) = 6 ? 4.1; Source data
are provided as a ?Source Data? file. E?I? Comparison of control disc (E, H, H?) and disc expressing dia-i in AMPs under htl-Gal4, showing changes in the
number of AMPs and AMP nuclei, morphologies, and orientations relative to the disc; G, G? DAPI and Twi-stained; E?G? and H?I? AMPs expressing
Lifeact:GFP and nls:GFP, respectively; red, phalloidin; arrowhead, actin-rich cell outline; * examples of giant nuclei within a large chamber; arrow in G? shows
the cytoplasmic space and thin Lifeact:GFP-marked membrane cortex surrounding each giant nucleus indicating hemifusion; dashed line in H and H?, tracheal
outline and AMP-disc junction, respectively. J?O Comparison between control (J?K?) and dia-i-expressing (L?O?) AMP clones for their proximo-distal
localization, polarity, and morphology; dashed arrow, distal cell/cytonemes, solid arrow, proximal cell/cytonemes, dashed line, AMP-disc junction, dashed
double-sided arrow, space between basal disc surfaces and distal clones; M?O? arrowhead, multi-nucleated cells (M), actin-rich (phalloidin stained and
Lifeact:GFP-marked) fusogenic synapse (N?O?). XY or YZ views are indicated. Genotypes: UAS-X/+, htl-Gal4/UAS-dia-i (D, F?G?, I, I?). UAS-FP/+; htl-Gal4/
+ (C, E, H, H?) HS-Flp/+; UAS-X/+; htl>FRT>stop>FRT>Gal4/+ (J?K?). HS-Flp/+; UAS-X/+; htl>FRT>stop>FRT>Gal4/UAS-dia-i (L?O?). X= FP, as indicated.
Scale bars: 20 ?m; 10 ?m (A, B, M?O).
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 7
htl>FRT>Lifeact:GFP    Phalloidin htl>nls:GFP  Phalloidin htl>Lifeact:GFP    Phalloidin
htl>Lifeact:GFP Phalloidin
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
at a hemifusion stage44, where only the contacting monolayers of dia-i clones were localized in the distal locations and lacked
cell membranes merged prior to the complete cytoplasmic nuclear dpERK (n= 320 clones, seven discs) (Fig. 5F, F?). Thus,
merger. This observation was consistent with a previous report disc-adhering orthogonal cytonemes are required for Htl
of Dia?s role at a step subsequent to the adhesion of fusion- signaling.
competent myoblasts (FCM)45. The reduction of AMP numbers To examine if the activation of Htl signaling is also required for
and concomitant formation of giant AMP nuclei also suggested the disc-specific orientation of AMP cytonemes, we expressed htl
an induction of cytoplasmic growth, probably by suppressing cell RNAi (htl-i) either under the htl-Gal4 control (Fig. 5G?G?, J?J??K)
division. Thus, the loss of AMP cytonemes led to the loss of AMP or in clones under htl>FRT>Gal4 control (Fig. 5H, I, L, L?). In
polarity, and instead facilitated fusogenic responses in AMPs control experiments, Lifeact:GFP-marked WT AMPs/AMP clones
required for differentiation. extended orthogonal cytonemes when localized in the disc-proximal
To further determine if cytonemes are required for both location and lateral cytonemes when present in the disc-distal
maintaining AMP polarity/niche occupancy and inhibiting location. In contrast, htl-knockdown AMPs exclusively lacked the
fusion, we generated Lifeact:GFP-marked single-cell AMP orthogonally polarized disc-specific cytonemes (Fig. 5G?I and
clones expressing dia-i. In comparison to control clones, dia Supplementary Table 2). Importantly, the lateral polarity of
mutant clones had non-polar spherical shapes, and lacked AMPs/AMP cytonemes were unaffected by the htl-i condition
cytonemes (Fig. 4J?O and Supplementary Table 2). Importantly, (Fig. 5G?I, J?L?). Thus, activation of Htl signaling in AMP is
while WT AMP clones occurred at random positions along the required specifically for their disc-specific orthogonal polarity.
orthogonal p-d axis (Fig. 4J?K? and Supplementary Table 2),
cytoneme-deficient clones occurred only in the distal-most AMP
layers (Fig. 4L?O? and Supplementary Table 2). Cross-sections Cytoneme-mediated Htl signaling determines the positional
through these non-polar clones revealed their syncytial nature identity of AMPs. Since Htl signaling is required for the disc-
(2 4 nuclei/cell) (Fig. 4M). Many small mutant cells also specific polarity of AMP cytonemes, the effects of the loss of Htl?
adhered to each other, forming actin-rich synapses, similar to signaling on AMPs are expected to be similar to cytoneme-
those observed during myoblast fusion45 (Fig. 4M O ). These deficient dia-i expressing AMPs. Indeed, htl knockdown in Life-? ?
results provided evidence that polarized disc-adhering AMP act:GFP and nls:GFP-marked AMPs showed fewer AMPs and
cytonemes are required to predict disc-proximal AMP position, AMP layers with a concomitant increase in the AMP?AMP
and that the lack of these cytonemes induces AMPs to acquire adhesion, mimicking fusogenic responses (Fig. 5G?G?, J?J? and
disc-distal positions and morphologic hallmarks of a fusogenic Supplementary Tables 1 and 2). Importantly, unlike the complete
response. loss of polarity under the dia-i-expression, htl-i expressing AMPshad lost polarity only toward the disc. The mutant nls:GFP-
marked AMPs had their axes aligned parallel to the disc plane
(Fig. 5J, K).
AMP cytonemes polarize toward the disc by activating FGF
signaling. Disc-adhering cytonemes might also be required for When we generated htl-i expressing Lifeact:GFP-marked AMPclones. All of the mutant clones were positioned exclusively in the
contact-dependent reception of growth factors produced in the
disc, and the activation of signaling, in turn, might specify the disc-distal layer and only had laterally oriented cytonemes(Fig. 5H, I). Similarly, a comparison of nlsGFP marked WT
disc-specific polarity and fates in AMPs. Because the entire AMP
population expressed Htl (Supplementary Fig. 2B), which is an and htl-i-expressing clones showed that the mutant clones
46 specifically occupied the disc-distal layer (Fig. 5L, L?). Phospho-FGF-receptor for two FGFs, Pyramus (Pyr) and Thisbe (Ths) ,
we presumed that AMP cytonemes might be critical for Htl sig- histone (PH3)-staining (anaphase marker) of these tissuesindicated that the presence of disc-distal htl-i mutant clones in
naling. Previously, the crosstalk between the Wg and Htl sig-
naling was known to control AMP multiplication34,35, but wing disc did not affect the normal orthogonal polarity ofdivision axes of mitotically active AMPs in the disc-proximal
cytoneme-dependent Htl signaling was unknown. 30
Htl is the only FGFR that is expressed in the disc-associated layer, as reported before . Thus, we concluded that cytoneme-
38 meditated Htl signaling is required for disc-specific AMP polarity,AMPs . The second Drosophila FGFR, Breathless (Btl) is
specifically expressed in the disc-associated ASP and transverse positioning, and fates.
38 Altogether, these results suggested that AMP cytonemes areconnective to receive disc-derived Branchless/Bnl . To examine
if orthogonal AMP cytonemes localized Htl, we expressed required to integrate selective niche adherence and asymmetricHtl signaling. Adherence of cytonemes to the niche is required to
Htl:mCherry in CD2:GFP-marked AMPs. Hundred percent of
the CD2:GFP-marked AMP cytonemes that oriented toward the activate Htl signaling in AMPs and activation of Htl signaling in
fTRG AMPs is, in turn, required for niche-specific polarity and affinitydisc localized Htl:mCherry (Fig. 5A). A htl:GFP fly line that
expresses physiological levels of Htl:GFP47, also localized Htl:GFP of AMP cytonemes. Therefore, we presumed that to initiate andmaintain the asymmetrical patterns of these functions in an
on the entire population of orthogonal cytonemes (Fig. 5B and
Supplementary Movie 8). interdependent manner, Htl ligands are presented and delivered
To detect Htl-induced MAPK signaling in AMPs, we probed for from wing disc cells exclusively to the disc-occupying AMP
nuclear dpERK. AMPs with high levels of nuclear dpERK were cytonemes in a restricted target-specific manner.
located in the disc-proximal niche and most disc-distal AMPs
lacked the nuclear dpERK (Fig. 5C?C?). This asymmetric Spatially restricted expression of two FGFs produces distinct
distribution of Htl signaling correlated with the asymmetric p-d AMP niches. Htl ligand Ths is known to be expressed in the wing
distribution of orthogonal AMP cytonemes (Fig. 2A, B). To disc notum (Fig. 6A and see ref. 35). However, Htl-expressing
examine if orthogonal cytonemes in AMPs were required to AMPs and disc-adhering orthogonal AMP cytonemes also
induce Htl signaling, we generated CD8:RFP-marked control (w?) populated the disc area such as the hinge, which lacked ths
and dia-i expressing clones of AMPs and compared dpERK expression (Fig. 3A, H, H? and 6A and Supplementary Movie 8).
signaling between them. While ~49 of 52 WT control clones in the When ectopically expressed in the disc, Pyr could modulate the
disc-proximal location (96% ? 6.6; six discs) had dpERK spatial distribution of AMPs48, but Pyr expression in the disc was
(Fig. 5D?E?), only 3/92 disc-distal WT clones had dpERK unknown. We presumed that Pyr might be expressed in the ths-
(3% ? 3.6; six discs). In comparison, all of cytoneme-deficient free hinge areas to support AMPs adherence. To identify pyr
8 NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
expression in the wing disc, we first generated a pyr-Gal4 fly using to harbor direct flight muscle (DFM) progenitors, which express a
CRISPR/Cas9-based genome editing and verified its accurate homeobox transcription factor, Cut, while the indirect flight
spatial expression (Fig. 6B and Supplementary Fig. 3A?E). muscle (IFM) progenitors, which express high levels of Vestigial
Indeed, in the wing disc, pyr-Gal4 was highly expressed in the (Vg) and low levels of Cut, occupy the notum33. Since Vg and Cut
disc hinge areas that lacked ths expression (Fig. 6C). When both expression is stabilized by a mutually repressive feedback loop,
AMPs and the pyr source were marked, the spatial distribution of Vg-expressing IFM progenitors and Cut-expressing DFM pro-
AMPs over the hinge precisely coincided with the pyr expressing genitors appear to be mutually excluded from each other?s
zone. Thus, the wing disc niche is subdivided into two FGF- niche33. Cut and Vg immunostaining of discs with CD8:GFP-
producing niches: the Pyr-expressing hinge and the Ths- marked pyr and ths sources revealed that the pyr-expressing and
expressing notum. ths-expressing zones spatially correlated with the DFM and IFM
Two distinct FGF-expressing compartments might hold progenitor distribution, respectively (Fig. 6G?I). These results
different muscle-specific AMPs. The disc hinge area was known suggested that the Pyr-expressing and Ths-expressing niches
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 9
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
Fig. 5 AMP cytonemes localize Htl and require FGF signaling for disc-adherence. A CD2:GFP-marked AMP cytonemes (arrows) localize Htl:mCherry
(LexO-Htl:mCherry/+; htl-LexA, LexO-CD2:GFP/+). B Orthogonal AMP cytonemes localize Htl:GFPfTRG. C, C? nls:GFP-marked AMPs stained with anti-dpERK.
D?F? CD8:RFP-marked clones (green, pseudo-colored) of control and dia-i-expressing AMPs showing the FGF signaling state (nuclear dpERK, red); D drawing
depicting optical sections in E and E?, showing differences in numbers of dpERK positive clones between proximal (95.77% ?6.63 (?SD); 52 clones) and distal
(3.19% ?3.62; 92 clones) AMP layers (p < 0.0001)). G?L Effects of htl-i expression under either htl-Gal4 (G, G?, J, K) or htl>FRT>Gal4 (single cell clones; H, I, L,
L?); G, G?, J, K Discs harboring either Lifeact:GFP-marked (G, G?) or nls:GFP-marked (J, K) htl-i-expressing AMPs showing selective loss of-orthogonal
cytonemes (G, G?, cytoneme numbers/100 ?m of AMP-disc interface: control = 36.9 ? 3.8 and htl-i=0; p < 0.0001), cell polarity (H-K), AMP number and
layers (J, J?), and induction of fusogenic responses (G, G?, H, J?, J?). I Graphs comparing orthogonal and lateral cytoneme numbers per single-cell AMP clone;
Control proximal layer had only orthogonal cytonemes (average ? SD: 2.6 ? 0.9/cell; total n= 64 cytonemes/25 clones) and distal layer had only lateral
cytonemes (5.6 ? 1.8/cell; total n= 105 cytonemes/19 clones); htl-i-expressing clones were distal and had only lateral cytonemes (6.1 ? 1.7/cell; total n= 146
cytonemes/24 clones); error bars: SD; also see Supplementary Table 2. K Graphs comparing AMP nuclear angles (Theta, ?) in control (n= 125 proximal/58
distal nuclei) and htl-i-expressing AMPs (n= 33 nuclei; p < 0.0001). L, L? Discs with DAPI and PH3 staining showing relative location and orientation of nls:GFP-
marked control (L) and htl-i-expressing (L?) AMP clones. C, C?, E?L? dashed arrow, distal cells/cytonemes; solid arrow, proximal cell/cytonemes; dashed line,
AMP-disc junction; dashed double-sided arrow, space between the basal disc surface and the distal layer. Source data are provided as a ?Source Data? file; p-
values, unpaired two-tailed t-test. Genotypes: HS-Flp/+;UAS-X/+;htl>FRT>stop>FRT>Gal4/+ (E, E?, L). HS-Flp/+;UAS-X/+;htl>FRT>stop>FRT>Gal4/UAS-
diaRNAi (F, F?); HS-Flp/+;UAS-X/UAS-htlRNAi;htl>FRT>stop>FRT>Gal4/+ (H, I, L?). X= FP as indicated. Scale bars: 20 ?m; 30 ?m (C, C?); 10 ?m (E, E?).
promote the occupancy of different muscle-specific AMPs within the Ths:GFP-expressing discs harbored many disc-distal AMPs
the respective FGF-expressing zones. with MAPK signaling and orthogonal polarity (Fig. 7E, E? and
Since Htl is the only receptor for Pyr and Ths, and since all Supplementary Fig. 4A?B??). However, this increase in Ths
AMPs express Htl, selective affinity/adherence of DFM- signaling range was limited only to the ths-expressing zone. In the
progenitors to pyr-zone and IFM-progenitors to ths-zone, could same discs, AMPs in the neighboring pyr-expressing zone were
be due to the asymmetric niche-specific presentation and unaffected. Similarly, pyr-Gal4-driven Pyr:GFP expanded AMP
signaling of Pyr and Ths. To test this possibility, we performed pool size over the Pyr:GFP expressing niche, without affecting
RNAi-mediated knockdown of ths (ths-i) and pyr (pyr-i) from AMPs in the ths zone (Fig. 7F, F? and Supplementary Fig. 4A,
their respective sources and visualized niche-specific effects while C?C??).
marking the resident AMPs with CD2:GFP (Fig. 6J?P?). In To examine if Pyr:GFP and Ths:GFP were target-specifically
comparison to the control, ths-i expression under ths-Gal4 led to received by AMP cytonemes, we examined mCherryCAAX-
fewer AMPs, AMP layers, and disc-specific polarized cytonemes marked AMPs in discs expressing either Pyr:GFP or Ths:GFP
exclusively over the ths zone (Fig. 6J?L). Resident AMPs in the from their respective sources. High-resolution imaging of fixed
ths-expression zone had reduced dpERK (Fig. 6K?, L?). However, tissues revealed that disc-invading AMP cytonemes localized
ths-Gal4>ths-i conditions did not produce any detectable defects either Ths:GFP or Pyr:GFP puncta depending on the signal
in dpERK signaling and AMP cytonemes over the pyr-expressing source they contacted (Fig. 7G?J?). Notably, both Ths:GFP and
hinge (Fig. 6M?M?). Similarly, pyr>pyr-i conditions had fewer Pyr:GFP expressing wing disc cells localized high levels of signals
AMPs, AMP cytonemes, and, consequently, less dpERK signaling at the apico-lateral junctions, where AMP cytonemes had
over the pyr-Gal4-expressing hinge area (Fig. 6N?O?). However, established contacts (Fig. 7H, H?, J?J?). These results are
it did not affect signaling and polarized cytonemes in AMPs over consistent with the polarized presentation and target-specific
the ths zone (Fig. 6P, P?). These results suggested that disc-derived cytoneme-mediated Pyr and Ths uptake.
Pyr and Ths can promote signaling and orthogonal cytoneme To further examine if an ectopic Pyr and Ths expressing niche
formation exclusively in their respective expression zones. can induce AMP homing and cytoneme-mediated asymmetric
FGF-specific organizations, we ectopically expressed Pyr:GFP and
Cytoneme-dependent Pyr and Ths exchange between the AMP Ths:GFP under dpp-Gal4 control. Ectopic Pyr expression in the
and wing disc. Pyr and Ths signal through a single Htl disc pouch under dpp-Gal4 is known to induce AMP migration
receptor46. Therefore, we presumed that to hold two distinct onto the dpp-expressing zone48. To detect the spatial relationship
niche-specific AMP populations, Pyr and Ths would be restricted between the AMP and ectopic FGF-source, we marked the dpp
from freely dispersing into each other?s zones. To examine this source with mCherryCAAX and probed AMPs by Cut immu-
possibility, we generated Ths:GFP and Pyr:GFP constructs and nostaining. As expected, Ths:GFP and Pyr:GFP expression from
expressed them under ths-Gal4 and pyr-Gal4, respectively the dpp source induced AMP homing and establishment of
(Fig. 7A?J?, see ?Methods? section). As predicted, despite the ectopic niches by precisely overlapping with the dpp expressing
overexpression, Pyr:GFP and Ths:GFP were distributed exclu- pouch area (Fig. 8A?F and Supplementary Fig. 5A?C). These
sively in the AMPs that adhered to their respective expression results also suggested that Ths:GFP and Pyr:GFP constructs are
zones (Fig. 7A?D?). In addition, the levels of GFP-tagged signal functional.
were higher in the disc-proximal AMPs than the disc-distal In these ectopic niches, AMPs were orthogonally organized
AMPs (Fig. 7C?D?). This observation was consistent with high into a multi-stratified layer over the signal expressing dpp source.
levels of dpERK in disc-proximal AMPs (Fig. 5C?E?). Despite overexpression, Ths:GFP and Pyr:GFP puncta were
Ths:GFP-expressing disc epithelium had increased surface area asymmetrically distributed only to the disc-proximal AMPs
with many folds and projections (Fig. 7A?, A?), probably to hold (Fig. 8C?F). Importantly, Cut and Vg staining revealed that the
an expanding pool of hyper-proliferating AMPs. Ectopic over- proximal position of the Pyr:GFP-expressing niche was selectively
activation of FGF signaling in AMPs was known to increase the adhered by Cut-expressing AMPs, which lacked Vg expression,
AMP pool size35. Indeed, when AMP nuclei were marked with while high Vg-expressing AMPs, which had suppressed Cut
nls:RFP (htl-LexA>LexO-nls:RFP) in Ths:GFP expressing discs levels, were sorted out into the disc-distal location (Fig. 8C, D).
(ths-Gal4>UAS-Ths:GFP), we detected an increase in the number Similarly, Vg-expressing AMPs selectively adhered to the
of AMPs and AMP layers (12-15 layers in comparison to WT 4?5 Ths:GFP-expressing niche and high Cut-expressing AMPs were
layers; Supplementary Fig. 4A). Unlike the WT disc (Fig. 5C?E?), sorted to the distal layers (Fig. 8E, F). Thus, Pyr and Ths
10 NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
expressed from the dpp source produced ligand-specific cellular of the disc signal source (Fig. 8G). Single optical YZ sections
organization in the ectopic niche. across these cytonemes showed signal enrichment along the
To further visualize cytonemes from the niche-adhering cytoneme shafts, suggesting cytoneme-mediated Ths:GFP and
AMPs, we imaged mCherryCAAX-marked AMPs in the ectopic Pyr:GFP uptake from the ectopic source (Fig. 8G?-G?? H? and
Ths:GFP or Pyr:GFP-expressing dpp source (Fig. 8G?H?). Supplementary Fig. 5D, D?). These results showed that the
Proximal AMPs were polarized toward the ectopic niche and localized expression and presentation of Pyr and Ths, and their
extended niche-invading cytonemes toward the apical junctions cytoneme-mediated target-specific signaling can establish niche-
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 11
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
Fig. 6 Wing discs express Pyr and Ths in distinct zones to support different AMP subtypes. A Spatial patterns of ths-Gal4-driven mCherryCAAX
expression in the wing disc notum and the distribution of CD2:GFP-marked AMPs; arrow, ths expression-free hinge area; right panel, red channel from the left
panel. B Scheme depicting the genome editing strategy to generate a pyr-Gal4 enhancer trap construct (see Supplementary Fig. 3). C, DWing disc expression
patterns of pyr-Gal4-driven CD8:GFP (C) and mCherryCAAX (D) and its spatial correlation to the AMP distribution (D arrow). E?I Images showing CD8:GFP-
marked ths-Gal4 and pyr-Gal4 expression zones in wing discs and their correlation with the localization of IFM-specific (high Vg, blue; low Cut, red; dashed
arrow) and DFM-specific (high Cut, red; dashed arrow) progenitors; I schematic depicting the results of E?H. J?M? Images, showing effects of ths-i expression
from ths source (ths-Gal4; mCherryCAAX-marked, blue) on the resident AMPs (AMP number, cytonemes, polarity, multi-layered organization, and dpERK
signaling (red)) and non-resident AMPs (over the unmarked pyr-zone); dotted line (M?), ASP. N?P? Images showing effects of pyr-i expression from pyr
source (pyr-Gal4, blue area) on the resident AMPs and non-resident AMPs (unmarked ths-expression zone). J?P? solid arrows, pyr expression zone; dashed
arrow, ths-expression zone; dashed box, ROIs used to produce YZ views. Scale bars: 20 ?m.
specific asymmetric signaling and AMP organization patterns emerge in an interdependent manner along the p-d orthogonal
(Fig. 8I). axis relative to the niche (disc plane) via cytoneme-mediated
niche-AMP interactions (Fig. 8I).
Discussion The same FGF signaling feedback on AMP cytonemes can also
These findings show a critical role and mechanism of cytoneme- produce a second asymmetric AMP organization (Fig. 8I). AMPs
mediated signaling in generating asymmetric organizations in that give rise to DFM (express Cut) and IFMs (express high Vg
the stem cell niche. Previously, well-characterized Drosophila and low Cut) are known to be maintained in two distinct regions
stem cell niches have revealed that the niches require two basic of the wing disc, and a mutual inhibitory feedback between Cut
strategies to function ? adhesive niche-stem cell interactions and Vg is known to intrinsically reinforce the spatially separated
and asymmetric signaling49. In this study, high-resolution distribution of the two AMP subtypes33. We found that the wing
imaging in combination with genetic analyses revealed that disc AMP niche is subdivided into Pyr and Ths expressing zones
AMPs employ cytonemes to integrate these two essential func- that, in turn, support DFM-specific and IFM-specific AMPs,
tions, thereby constituting a central pathway that can generate respectively. Pyr and Ths signal to cells by binding to the com-
and maintain diverse niche-specific asymmetric signaling and mon Htl receptor46, but when Htl-containing AMP cytonemes
cellular organization. physically adhered to the Ths-expressing niche and received Ths,
We found that the mechanism of cytoneme-dependent AMP AMPs had IFM-specific fates and when AMP cytonemes adhered
organization is constituted of three basic steps (Fig. 8J). First, to the Pyr-expressing niche and received Pyr, AMPs had DFM-
AMPs extend cytonemes that orient toward the wing disc niche specific fates. We do not know whether Pyr/Ths signaling in
and invade through the intercellular space of niche epithelial cells AMPs can directly control the Vg or Cut expression. However,
to adhere AMPs to the disc cell junctions. This is a dynamic based on the experimental evidence from the ectopic Pyr/Ths-
process, which enables multiple AMPs to share the limited niche producing AMP niches (Fig. 8A?F), we conclude that the DFM
area through cytonemes. Second, these cytonemes localize FGFR/ precursors selectively adhere to the Pyr-expressing niche, and the
Heartless (Htl) to select and adhere to only the FGF-producing IFM precursors selectively adhere to the Ths-expressing niche.
disc areas and directly receive the disc-produced FGF. Third, the Therefore, the self-promoting FGF signaling feedback on FGF-
activation of FGF signaling promotes AMPs to extend polarized receiving AMP cytonemes can organize and reinforce diverse
FGFR-containing cytonemes toward the disc and reinforce their niche-specific AMP organization. However, the final architecture
polarity/affinity toward the selected signal-producing niche. of AMP organization is controlled extrinsically by the expression
A consequence of this mechanism appears to be an FGF sig- and presentation patterns of niche-derived FGFs. We found that
naling feedback controlling the polarity and affinity of AMP Pyr and Ths-expressing wing disc cells restrict random secretion/
cytonemes toward an FGF-producing niche. Without FGF sig- dispersion of FGFs and target their release only through
naling, AMPs are unable to polarize cytonemes toward the FGF- cytoneme-mediated AMP-niche contacts. How source cells
producing disc and adhere to the disc adherens junctions and ensure target-specific Pyr and Ths release is unclear. A recent
without the disc-specific polarity and adhesion of cytonemes, discovery shows that Pyr is a transmembrane protein50 and
AMPs are unable to receive FGF and activate FGF signaling transmembrane tethering might ensure its cytoneme-dependent
(Fig. 8J). Such interdependent relationship of the cause and exchange. Moreover, both Pyr and Ths are enriched at the apical
consequence of cytoneme-mediated FGF signaling can integrate junctions of the disc (see ref. 50; Fig. 7G, H) where AMP cyto-
multiple functions, including sensing and adhering to a specific nemes establish contacts.
FGF-producing niche, receiving FGFs in a polarized manner, and These findings also might implicate that the alteration of
activating a signaling response to self-reinforce polarity, position, cytoneme polarity, adhesion, and signaling specificity can deter-
and signaling fates. mine differential fates/functions. For instance, although distal
Our results suggest that this self-regulatory property of cyto- AMPs do not extend cytonemes toward the disc, they extend
nemes can self-organize diverse niche-specific asymmetric pat- cytonemes toward each other and toward the TC/ASP. Our
terns (Fig. 8I). For instance, disc-proximal AMPs can determine results suggest that the TC/ASP might act as a niche for distal
and reinforce their positional identity and orientation relative to AMPs. Moreover, cytoneme-dependent interactions between the
the disc by employing the FGF signaling feedback on cytoneme TC/ASP and AMPs are known to mediate Notch signaling36.
polarity and adhesion. Cytoneme-dependent adhesion might also Similarly, filopodial tethering of embryonic AMPs to surrounding
be the basis of the orthogonally polarized division of disc- muscles facilitate insulin and Notch signaling to control quies-
proximal AMPs30. With increased orthogonal distances from the cence and reactivation51. Filopodia are also essential for
disc, AMPs lose the niche-specific adhesion, FGF signaling, and AMP::AMP/myotube fusion during myogenesis45,52. Thus, the
polarity, and, instead, gain morphologic hallmarks required for same AMP filopodia/cytoneme can dynamically balance between
AMP differentiation. Notably, AMP cytonemes integrate all these different fates/functions, including quiescence, reactivation,
functions simply by establishing or removing contacts with the stemness, and differentiation, depending on where and when they
niche. Consequently, asymmetric cellular and signaling patterns establish contacts.
12 NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
Fig. 7 Cytoneme-mediated FGF exchange generates niche-specific asymmetric signaling. A, B? XY and YZ views (as indicated) of wing discs expressing
mCherryCAAX and either Ths:GFP under ths-Gal4 (A, A?) or Pyr:GFP under pyr-Gal4 (B, B?). C, D? Images of wing discs harboring mCherryCAAX-marked
AMPs; wing discs expressing either Ths:GFP or Pyr:GFP as indicated. A?D? dashed arrow, signal in the source; arrow, non-autonomous punctate
distribution in the AMP; *, non-expressing areas of the lacking signal distribution. E, F? Wing discs expressing either Ths:GFP or Pyr:GFP as indicated,
showing niche-specific effects of signal overexpression on proliferation of niche-resident and non-resident AMPs (nls:GFP marked); thick and thin dashed
line, interface between AMPs and ths-expression and pyr-expression zones, respectively; dashed and solid arrows, effects on ths-expression and pyr-
expression zones, respectively. G?J YZ views of wing discs expressing either Ths:GFP or Pyr:GFP as indicated and harboring mCherryCAAX-marked AMPs,
showing disc-invading cytonemes receiving GFP-tagged signal (arrow) from the disc cells; arrowheads, localized signal enrichment in source cells. Scale
bars: 20?m; 5 ?m (H, H?).
The molecular mechanisms that produce AMP-niche contacts neuronal synapses43, the niche-AMP cytoneme contact sites
and control contact-dependent Pyr/Ths exchange are unknown. might recruit neuron-like molecular and cellular events to
Our n-syb-GRASP experiments showed that the AMP-niche exchange signals. This is consistent with previous reports showing
cytoneme contacts trans-synaptically reconstitute split n-syb GFP. that cytonemes share many biochemical and functional features
Since n-Syb containing vesicles are targeted specifically to the with neuronal communication16,53,54.
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 13
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
A Ectopic dpp>Ths/Pyr htl-LexA>mCherryCAAX
AMP niche
Cut Vg G G? G? G??
Vg Cut
*
Ths:GFP Pyr:GFP *
dpp>Gal4, mCherryCAAX
B A P B?
H H?
y z A P
x x Cut
C D Vg
A P
Cut A P
E F Vg
*
* *
* *
A P Cut A P
I Trachea J
Basal lam
ina
Z Niche-specific
Differen- AMP Identity
tiation Distal
IFMs DFMs Signaling
Stemness Proximal
Basal
Cytoneme
Niche adhesion
and polarized 
Cell FGF uptake via 
Apical Ths Pyr junctions cytonemes
Ths zone Pyr zone X/Y
AMP subtypes (DFM or IFM)
Fig. 8 Cytoneme-mediated FGF-specific organizations in ectopic niches. A?F Asymmetric FGF signaling and ligand-specific organization of DFM-specific
(?Cut, blue) and IFM-specific (?Vg, blue) AMPs when dpp-Gal4 ectopically expressed either Pyr:GFP or Ths:GFP (dpp-Gal4>UAS-Pyr:GFP or Ths:GFP,>UAS-
mCherryCAAX) in the wing disc pouch as illustrated in A; A Drawing depicting the experiments and results in B?F; dashed line, AMP-disc junctions; B? XZ
section from ROI in B; dashed and solid arrows, Cut and Vg expressing AMPs, respectively; double-sided arrow (D), proximal zone of Pyr:GFP expressing
niche lacking Vg-positive AMPs. G, G?? Wing disc pouch expressing Ths:GFP under dpp-Gal4 and showing mCherryCAAX-marked AMP and AMP
cytonemes; *, proximal AMPs with orthogonal polarity and cytonemes; G?, G??, single optical sections showing Ths:GFP on cytonemes (arrowheads);
dashed lines, disc epithelium. H, H? Wing disc pouch expressing Pyr:GFP under dpp-Gal4 and showing mCherryCAAX-marked AMP and AMP cytonemes;
arrowhead, Pyr:GFP on cytonemes. I, J Models for the niche-specific asymmetric signaling and organization via cytonemes-mediated Pyr and Ths signaling
(I) and signaling feedbacks reinforcing the cytoneme polarity and adhesion (J). Scale bars: 20 ?m.
Cytoneme-deficiency in AMPs caused pupal lethality, which epithelium to hold hyperproliferating AMPs within the niche
might suggest that the contact-dependent signaling via cyto- (Fig. 7A?, A?).
nemes plays an important role in muscle development/home- Collectively, these results establish an essential role of FGF
ostasis. Moreover, a recent study showed that cytoneme- signaling in regulating AMP homing, niche occupancy, and
dependent FGF?FGFR interactions between the ASP and wing niche-specific organizations. FGF signaling achieves these goals
disc induces bidirectional responses21. It is likely that similar by controlling niche-specific polarity and affinity of AMP cyto-
cytoneme-dependent bidirectional receptor?ligand interactions nemes (Figs. 5G?L and 8A?H? and Supplementary Fig. 5A?C).
can simultaneously control both wing disc and AMP organiza- However, additional signaling inputs and their crosstalk with the
tion. For instance, wing disc and AMP cells extend polarized FGF signaling pathway might be required to specify different
cytonemes toward each other (Fig. 2D, F). The loss of AMP muscle-specific transcriptional fates in AMPs. For instance, wing
cytonemes alters the morphology of the wing disc epithelium disc-derived Wg/Wingless30,36, Hedgehog (Hh)48,55,56, and Ser-
(Supplementary Fig. 7A?C). Similarly, overexpression of FGFs rate (Ser)30 are required for different AMP fates or functions.
from the disc induces folds and projections from the wing disc Moreover, crosstalk between Htl and Wg signaling or Wg and
14 NATURE COMMUNICATIONS |         (2022)1 3:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Myogenic differentiation Ths:GFP Pyr:GFP Control
Disc cells
dpp-Gal4>Pyr:GFP dpp-Gal4>Ths:GFP
Fates
AMPs
Niche-specific
Polarity & adhesion
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
Notch signaling pathways are critical for AMP proliferation/ genomic region upstream of the insertion site, and the 3? HA contained
fates34,35. We speculate that the cytoneme-dependent adherence 1.3 kb of pyr genomic region downstream of the insertion site and were
to a speci c FGF-expressing niche exposes AMPs to many other amplified from the genomic DNA (gDNA) of the nos-Cas9 fly as describedfi
in refs. 59,62. The T2A-nls:Gal4:VP16-STOP sequence was generated by PCR
signal sources that overlap with the FGF-producing zone. For (Supplementary Table 3) from the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4
instance, we found that ~24% of the disc-occupying cytonemes in attB vector (Addgene). 5?HA-T2A-nls:Gal4:VP16-STOP-3?HA was
the ths-zone overlap with the disc Wg source, and these cyto- assembled in correct 5?-to-3? order between Not1 and EcoR1 sites of the
nemes localize Fz:Cherry (Supplementary Fig. 6A?D?36). In the pJet1.2 vector.
The insertion of the ?T2A-nls:Gal4:VP16-STOP? cassette did not affect cis-
future, it will be interesting to explore if the cytoneme-dependent regulatory elements and the original splicing sites of pyr second coding exon.
niche occupancy can facilitate signaling crosstalk to specify dif- This enables the expression of a full-length pyr mRNA tagged with the Gal4-
ferent muscle-specific AMP fates. expressing cassette. Expression of this chimeric pyr mRNA in cells is probed
FGF signaling pathway is critical to specify a wide range of with its translation into the nls:Gal4:VP16 protein, which can transactivate
functions, including self-renewal and differentiation of many reporters under UAS control (Supplementary Fig. 3B?E). Translation of this
57,58 chimeric mRNA begins from the WT 5? end of pyr mRNA, producing avertebrate stem cells . In this context, our results establish a 9-amino acid long N-terminal native Pyr protein, followed by the self-
unique perspective of FGF signaling at the level of signaling input, cleaving T2A peptide and nls:Gal4:VP16. Translation terminates at the stop
where the same FGF and signaling pathway can balance between codon inserted immediately after the nls:Gal4:VP16 CDS. The T2A-peptide
different functions, fates, or organizations of stem cells, simply by cleaves off the nine N-terminal Pyr amino acids from the nls:Gal4:VP16protein. Although the chimeric mRNA contains pyr CDS, the presence of
controlling when and where the cells might establish cytoneme- stop codons in all three frames immediately 3? to the nls:Gal4:VP16 CDS
mediated FGF signaling contacts. An asymmetric signaling blocks any further downstream translation. Thus, the engineered locus allele
microenvironment is required not only to hold stem cells, control is functionally a null pyr allele.
their proliferation, and repress differentiation inside the niche, c. Embryo Injection, fly genetics, and screening. pCFD3-pyr-Gal4-gRNA and the
replacement cassette plasmids were co-injected in {nos-Cas9}ZH-2A (BL
but also to guide organized patterns of differentiation of stem 54591) embryos following59,62. For screening the genome edited flies, single
cells outside the niche49. Therefore, our findings, showing how G0 adults were crossed to Pin/CyO; UAS-CD8:GFP flies and GFP-positive
polarized signaling and cellular interactions through cytonemes larvae from each cross were separated out, reared till adults, which were
generate and maintain diverse niche-speci c signaling and cel- individually crossed to Pin/CyO; UAS-CD8:GFP virgins. When the F2 larvaefi
emerged, the single F1 father from each cross was sacrificed for genomic
lular asymmetry, have broad implications. DNA preparation and PCR-based screening as described in Du et al.59,62.
Genomic DNA extracted from {nos-Cas9}ZH-2A fly served as the negative
Methods control. PCR screening for the presence of T2A-Gal4 within the endogenous
Drosophila melanogaster stocks. All ies were raised at 25 ?C with 12 h/12 h light/ pyr locus was performed using primer sets ?gRNAseqF2? and ?Seq2R?;fl
dark cycle unless noted. This study: htl-LexA, pyr-Gal4/CyO, htl>FRT>stop>FRT>- ?Seq2F? and ?gRNAseqR1?; and ?pJet seqR? and ?CseqF? (for ends-out)
Gal4, UAS-Pyr:GFP, UAS-Ths:GFP and LexO-Htl:mCherry. All new transgenic (Supplementary Fig. 3A and Supplementary Table 3). The correct lines were
injections were performed by Rainbow Transgenic Flies, Inc. Bloomington Droso- used for establishing balanced fly stocks prior to sequence verification. 30/32
phila Stock Center: UAS-CD8:GFP, UAS-CD8:RFP, UAS-mCherryCAAX, LexO- F1-parent lines had successful HDR. 29/30 lines had correct ?ends-out?
CD2:GFP, UAS-Eb1:GFP, UAS-Lifeact:GFP, UAS-nls:GFP, UAS-nls:mCherry, htl- HDR. Two ?ends-out? fly lines were used for full sequencing of the
Gal4, ths-Gal4/CyO, UAS-Dia:GFP, UAS-?DAD-Dia:GFP, UAS-pyrRNAi, UAS-dia- engineered locus. These flies were outcrossed to establish final stocks for
RNAi, hs-Flp, {nos-Cas9}ZH-2A, and w1118. Vienna Drosophila Resource Center: subsequent use. The accurate pyr-Gal4 expression patterns in flies were
htl:GFPfTRG, UAS-htlRNAi, and UAS-thsRNAi. Other sources: LexO-nsyb:GFP1?10, confirmed by comparing the observed patterns with the published pyr
46,63
UAS-CD4:GFP1120. LexO-mCherryCAAX15. dpp-Gal4/CyO, LexO-Fz:mCherry and mRNA in-situ hybridization patterns (Supplementary Fig. 3B?E).
1151-Gal4 from Huang et al.36 (also see Supplementary Table 3).
Immunohistochemistry. All immunostainings were carried out following proto-
Molecular cloning and generation of transgenic Drosophila lines. All over- cols described in
20. Antibodies used in this study: ?-Discs large (1:100 DSHB 4F3),
expression constructs described were cloned using the primers and cloning kits ?-PH3 (1:2000 Cell Signaling Technology 9701), ?-dpERK (1:250 Sigma Aldrich
listed in the Supplementary Table 3. In UAS-Pyr:GFP, an ectopic super-folder-GFP M-8159), ?-Ct (1:50 DSHB 2B10), ?-Shotgun (1:50 DSHB DCAD2), ?-Arm (1:100
sequence was inserted in frame between T and T of the original 766 amino- DSHB N2 7A1), ?-Wg (1:50 DSHB 4D4), ?-Vg (1:200 Gift from Kirsten Guss), ?-208 209
acid-long Pyr. In UAS-Ths:GFP, the ?VEGQGG linker- super-folder-GFP- Twi (1:2000 gift from S. Roth), Phalloidin-iFlor 647 and Phalloidin-iFlor 555
GSGGGS linker? sequence was inserted in frame between S and V of the (1:2000 Abcam ab176756 and ab176759, respectively). Alexa Fluor-conjugated137 138
original 748 amino acids long Ths. LexO-Htl:mCherry consists of a htl CDS secondary antibodies (1:1000, Thermo Fisher Scientific) were used for immuno-
ampli ed from genomic DNA fused in frame with a C-terminal VEGQGG- fluorescence detection (see Supplementary Table 3 for details).fi
mCherry-STOP sequence in pLOT vector.
To make pHtl-enh-FRT-stop-FRT3-FRT-FRT3-Gal4 (htl>FRT>stop>FRT>Gal4), Mosaic analyses. To generate FLP-out clones of AMPs of various genotypes,
htl cis-regulatory element from P{GMR93H07-Gal4} construct (gift from G. females of hsflp; htl>FRT>stop>FRT>Gal4; UAS-X flies (X=UAS-CD8:GFP, UAS-
Rubin) was used to replace the pAct of the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 CD8:RFP, UAS-nls:GFP or UAS-Lifeact:GFP) were crossed to w1118 (control), UAS-
attB vector (Addgene #52889). To make pBP-htl-enh-nlsLexA::p65Uw (htl-LexA), diaRNAi (for dia knockdown), or UAS-htlRNAi (for htl knockdown) male flies.
the htl cis-regulatory element was cloned into pBPnlsLexA::p65Uw vector (Addgene Crosses were reared at room temperature and clones were induced by heat shock
#26230) using Gateway cloning (ThermoFisher). The resulting following standard methods prior to analyses as described in ref. 20.
htl>FRT>stop>FRT>Gal4 and htl-LexA constructs were injected using the phiC31
site-specific integration system into flies carrying the attP2 landing site. For other
constructs, transgenic flies were generated by P-element mediated germline Electron microscopy. After careful dissection from larvae, wing discs from w1118
transformation in w1118 flies. larvae were immersed in a fixative mixture of 2.5% glutaraldehyde (GA) and 2.5%
paraformaldehyde (PFA) in 0.1 M sodium cacodylate buffer, pH 7.4 at room
temperature for at least 60 min. Buffer washes (0.1 M sodium cacodylate) to
Generation of pyr-Gal4 transgenic Drosophila. To generate the pyr-Gal4 driver,
59 remove excess initial fixative preceded a 60 min secondary fixation in 1% osmiumwe followed a standard method described earlier in Du et al. . Briefly: tetroxide reduced with 1% ferrocyanide64 in 0.1 M sodium cacodylate buffer. After
a. gRNA design and cloning. Single gRNA target site was selected within the washing in distilled water, the discs were placed in 2% aqueous uranyl acetate for
second coding exon of pyr using the tools described earlier in Gratz et al. 60 min before dehydrating in an ascending series of ethanol (35?100%). The discs
and Du et al.59,60. The genomic gRNA binding site of the host fly chosen for were then infiltrated with propylene oxide, low viscosity epoxy resin series before
injection (nos-Cas9, BL# 54591) was sequence verified. The gRNA (PAM is polymerization of the resin at 70 ?C for 8?12 h. Thin sections (60?90 nm) were cut
underlined): 5? ATAATATAAGTCCTGACATTGGG 3?. pCFD3-pyr-Gal4- from the polymerized blocks with a Reichert-Jung Ultracut E ultramicrotome,
gRNA was cloned using methods outlined in Port et al.61. placed on 200 mesh copper grids, and stained with 0.2% lead citrate
65. Images were
b. Replacement cassette design. The replacement donor was designed to insert recorded at 80 kV on a Hitachi HT7700 transmission electron microscope.
?T2A-nls:Gal4:VP16-STOP? coding sequence into the second coding exon
of pyr (Supplementary Fig. 3A). Insertion site was at 25 nt after the 5? end of Live imaging of ex-vivo cultured wing discs. Long-term live imaging of ex-vivo
the exon and 21 nt before the 3? of the exon. Insertion of this cassette into cultured wing discs was performed using a custom-built 3D-printed imaging
the targeted genomic site disrupts the gRNA binding site to prevent post- chamber following Barbosa and Kornberg66. Wing discs were carefully dissected in
editing gRNA binding. The 5? homology arm (HA) contained 1.2 kb of pyr WM1 media and cultured within a 3D-printed imaging chamber placed over a
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 15
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
glass-bottom dish. Wing discs were oriented to face the peripodial side toward the Code availability
glass-bottom imaging surface for better AMP cytoneme detection deep inside the The code for triple-view image/movie is available at the following link: https://
tissue. Time-lapse movies were captured at 1 min intervals using a 40? oil objective github.com/hroi-aim/multiviewSR.
(1.4NA) in a spinning disc confocal microscope.
Received: 3 September 2021; Accepted: 2 February 2022;
Light microscopy and image processing
Spinning disc and line-scanning confocal. For most experiments, we used a Yoko-
gawa CSUX1 spinning disc confocal system equipped with an iXon 897 EMCCD
camera and Zeiss LSM 900 with Airyscan 2 and GaAsP detectors. Images were
resolved using either 20? (0.5 NA), 40? (1.3 NA oil), 60? (1.4 NA oil, Spinning
disc), or 63? (1.4 NA oil for LSM Airyscan) objectives. References
1. Yamashita, Y. M., Yuan, H., Cheng, J. & Hunt, A. J. Polarity in stem cell
Triple-view line confocal. For deep-tissue high-resolution imaging within a large 3D division: asymmetric stem cell division in tissue homeostasis. Cold Spring
volume (Fig. 3B?D?), we used triple-view line-confocal microscopy as described in
67 Harb. Perspect. Biol. 2, a001313 (2010).Wu et al. . Wing discs of the genotype ths-Gal4/UAS-nls:mCherry; htl-LexA/ 2. Losick, V. P., Morris, L. X., Fox, D. T. & Spradling, A. Drosophila stem cell
LexO-CD2:GFP were fixed in 4% PFA, washed 3? with 0.1% PBST, and mounted niches: a decade of discovery suggests a unified view of stem cell regulation.
on a poly-L-lysine-coated coverslip held inside a custom-designed imaging cham-
Dev. Cell 21, 159?171 (2011).
ber (Applied Scientific Instrumentation, I-2450) with the peripodial side of the
discs facing the cover-slip (Fig. 3B). The chamber was mounted onto the micro- 3. Florian, M. C. & Geiger, H. Concise review: polarity in stem cells, disease, and
scope stage and filled with 1? PBS prior to imaging. Image volumes were captured aging. Stem Cells 28, 1623?1629 (2010).
using one 60? objective (1.2 NA water immersion lens) beneath the coverslip and 4. Morrison, S. J. & Spradling, A. C. Stem cells and niches: mechanisms that
two 40? objectives (0.8 NA water dipping lenses) assembled at 90 degrees to each promote stem cell maintenance throughout life. Cell 132, 598?611 (2008).
other, imaging the sample from above. All three confocal views were registered and 5. Venkei, Z. G. & Yamashita, Y. M. Emerging mechanisms of asymmetric stem
merged with additive deconvolution to improve axial resolution and recover signals cell division. J. Cell Biol. 217, 3785?3795 (2018).
that would otherwise be lost due to scattering42. 6. Nystul, T. G. & Spradling, A. C. Breaking out of the mold: diversity within
adult stem cells and their niches. Curr. Opin. Genet. Dev. 16, 463?468 (2006).
Image processing. All images were processed using Fiji, MATLAB, or Imaris soft- 7. Li, L. & Xie, T. Stem cell niche: structure and function. Annu. Rev. Cell Dev.
ware. The registration and deconvolution of triple-view line confocal images were Biol. 21, 605?631 (2005).
performed with a custom-written software in MATLAB (MathWorks, R2019b, 8. Zhang, J. & Li, L. Stem cell niche: microenvironment and beyond. J. Biol.
using the Image Processing and Parallel Computing Toolboxes). Chem. 283, 9499?9503 (2008).
9. Rompolas, P., Mesa, K. R. & Greco, V. Spatial organization within a niche as a
determinant of stem-cell fate. Nature 502, 513?518 (2013).
Quantitation of cell number. Cell numbers were manually counted from 10. Yu, F., Kuo, C. T. & Jan, Y.-N. Drosophila neuroblast asymmetric cell division:
sequential 25 ?m thick YZ maximum intensity sections visualized in Imaris to recent advances and implications for stem cell biology. Neuron 51, 13?20 (2006).
cover clones within the entire disc area. 11. Yamashita, Y. M., Fuller, M. T. & Jones, D. L. Signaling in stem cell niches:
lessons from the Drosophila germline. J. Cell Sci. 118, 665?672 (2005).
Quantitation of cytonemes numbers, length, and dynamics. Cytonemes were 12. Buszczak, M., Inaba, M. & Yamashita, Y. M. Signaling by cellular protrusions:
manually counted from the maximum intensity YZ projections derived from 25 ?m keeping the conversation private. Trends Cell Biol. 26, 526?534 (2016).
thick YZ sections taken at the center of the disc. For comparative analyses, identical 13. Habib, S. J. et al. A localized Wnt signal orients asymmetric stem cell division
central areas from discs of different genotypes were chosen, and cytoneme counts in vitro. Science 339, 1445?1448 (2013).
were normalized per 100 ?m using a line drawn along the disc-AMP junction in each 14. Ram?rez-Weber, F. A. & Kornberg, T. B. Cytonemes: cellular processes that
YZ section. Cytoneme length represents the length between the base and tip of a project to the principal signaling center in Drosophila imaginal discs. Cell 97,
cytoneme. Niche occupancy or cytoneme density (Fig. 2I) was measured by counting 599?607 (1999).
the number of cytonemes at every 5min interval from a 1400 ?m2 ROI in YZ 15. Roy, S., Huang, H., Liu, S. & Kornberg, T. B. Cytoneme-mediated contact-
sections obtained using Imaris. Cytoneme dynamics were measured following21. dependent transport of the Drosophila decapentaplegic signaling protein.
Average extension and retraction rates represent the averaged extension and Science 343, 1244624?1244624 (2014).
retraction rates of the observed cytoneme during its respective lifetime. The exten- 16. Kornberg, T. B. & Roy, S. Communicating by touch-neurons are not alone.
sion and retraction rate of a given cytoneme represents the positive and negative Trends Cell Biol. 24, 370?376 (2014).
slope respectively of the experimentally measured cytoneme-length data graph 17. Roy, S., Hsiung, F. & Kornberg, T. B. Specificity of Drosophila cytonemes for
during its lifetime. The lifetime of a cytoneme constitutes the total time for the distinct signaling pathways. Science 332, 354?358 (2011).
extension and retraction cycle of a given cytoneme during the period of observation. 18. Bischoff, M. et al. Cytonemes are required for the establishment of a normal
Hedgehog morphogen gradient in Drosophila epithelia. Nat. Cell Biol. 15,
Quantitation of cell polarity. The polarity of a cell/nucleus was measured by the 1269?1281 (2013).
angle ? between the major axis of an elliptical cell/nucleus and the disc plane 19. Stanganello, E. & Scholpp, S. Role of cytonemes in Wnt transport. J. Cell Sci.
immediately under the cell/nucleus, as shown in Fig. 1G. 129, 665?672 (2016).
20. Du, L., Sohr, A., Yan, G. & Roy, S. Feedback regulation of cytoneme-mediated
Quantification of colocalization of Ths:GFP on cytonemes. We used FIJI to transport shapes a tissue-specific FGF morphogen gradient. Elife 7, e38137
derive intensity profiles across Ths:GFP puncta and cytonemes from single XZ and (2018).
ZY slices and analyzed the profiles for apparent colocalization. Ths:GFP puncta 21. Du, L., Sohr, A. & Roy, S. GPI-anchored FGF directs cytoneme-mediated
and cytonemes were colocalized to within one pixel (i.e., 97.5 nm) (Supplementary bidirectional signaling to self-regulate tissue-specific dispersion. Preprint at
Fig. 5D, D?). For graphs in Supplementary Fig. 5D, D?, fluorescence intensities were bioRxiv https://doi.org/10.1101/2021.02.23.432493 (2021).
normalized to the maximum intensity. 22. Hall, E. T. et al. Cytoneme delivery of Sonic Hedgehog from ligand-producing
cells requires Myosin 10 and a Dispatched-BOC/CDON co-receptor complex.
Elife 10, e61432 (2021).
Statistics and reproducibility. Statistical analyses were performed using Vassar- 23. Kornberg, T. B. & Roy, S. Cytonemes as specialized signaling filopodia.
Stat and GraphPad Prism 8. p-values were determined using the unpaired two- Development 141, 729?736 (2014).
tailed t-test for pair-wise comparisons or the ANOVA test followed by Tukey?s
24. Zhang, C. & Scholpp, S. Cytonemes in development. Curr. Opin. Genet. Dev.
honestly significant difference (HSD) test for comparison of multiple groups.
Differences were considered significant when p-values were <0.05. All measure- 57, 25?30 (2019).
ments were obtained from at least three independent experiments. All graphs and 25. Gonz?lez-Mendez, L., Gradilla, A.-C. & Guerrero, I. The cytoneme
kymographs were generated using GraphPad Prism 8. connection: direct long-distance signal transfer during development.
Development 146, dev174607 (2019).
26. Rojas-Rios, P., Guerrero, I. & Gonzalez-Reyes, A. Cytoneme-mediated delivery
Reporting summary. Further information on research design is available in the Nature of hedgehog regulates the expression of bone morphogenetic proteins to
Research Reporting Summary linked to this article. maintain germline stem cells in Drosophila. PLoS Biol. 10, e1001298?13
(2012).
Data availability 27. Inaba, M., Buszczak, M. & Yamashita, Y. M. Nanotubes mediate niche-stem-
The data generated in this study are provided in the Main Article and cell signalling in the Drosophila testis. Nature 523, 329?332 (2015).
associated Supplementary Information. Source data are provided with this paper. 28. Junyent, S. et al. Specialized cytonemes induce self-organization of stem cells.
Proc. Natl Acad. Sci. USA 117, 7236?7244 (2020).
16 NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
29. Fernandes, J., Bate, M. & VijayRaghavan, K. Development of the indirect flight 58. Huang, Y. et al. Type 2 fibroblast growth factor receptor signaling preserves
muscles of Drosophila. Development 113, 67?77 (1991). stemness and prevents differentiation of prostate stem cells from the basal
30. Gunage, R. D., Reichert, H. & VijayRaghavan, K. Identification of a new stem compartment. J. Biol. Chem. 290, 17753?17761 (2015).
cell population that generates Drosophila flight muscles. Elife 3, e03126 (2014). 59. Du, L. et al. Unique patterns of organization and migration of FGF-expressing
31. Bate, M., Rushton, E. & Currie, D. A. Cells with persistent twist expression are cells during Drosophila morphogenesis. Dev. Biol. 427, 35?48 (2017).
the embryonic precursors of adult muscles in Drosophila. Development 113, 60. Gratz, S. J. et al. Highly specific and efficient CRISPR/Cas9-catalyzed
79?89 (1991). homology-directed repair in Drosophila. Genetics 196, 961?971 (2014).
32. Roy, S. & VijayRaghavan, K. Muscle pattern diversification in Drosophila: the 61. Port, F., Chen, H. M., Lee, T. & Bullock, S. L. An optimized CRISPR/Cas
story of imaginal myogenesis. Bioessays 21, 486?498 (1999). toolbox for efficient germline and somatic genome engineering in Drosophila.
33. Sudarsan, V., Anant, S., Guptan, P., VijayRaghavan, K. & Skaer, H. Myoblast Proc. Natl. Acad. Sci. 111, E2967?E2976 (2014).
diversification and ectodermal signaling in Drosophila. Dev. Cell 1, 829?839 62. Du, L., Zhou, A., Sohr, A. & Roy, S. An efficient strategy for generating tissue-
(2001). specific binary transcription systems in Drosophila by genome editing. J. Vis.
34. Gunage, R. D., Dhanyasi, N., Reichert, H. & VijayRaghavan, K. Drosophila Exp. https://doi.org/10.3791/58268 (2018).
adult muscle development and regeneration. Semin. Cell Dev. Biol. 72, 56?66 63. Yang, S. et al. FGF signaling directs myotube guidance by regulating Rac
(2017). activity. Development 147, dev183624 (2020).
35. Vishal, K., Lovato, T. L., Bragg, C., Chechenova, M. B. & Cripps, R. M. FGF 64. Rivlin, P. K. & Raymond, P. A. Use of osmium tetroxide-potassium
signaling promotes myoblast proliferation through activation of wingless ferricyanide in reconstructing cells from serial ultrathin sections. J. Neurosci.
signaling. Dev. Biol. 464, 1?10 (2020). Methods 20, 23?33 (1987).
36. Huang, H. & Kornberg, T. B. Myoblast cytonemes mediate Wg signaling from 65. Venable, J. H. & Coggeshall, R. A simplified lead citrate stain for use in
the wing imaginal disc and Delta-Notch signaling to the air sac primordium. electron microscopy. J. Cell Biol. 25, 407?408 (1965).
Elife 4, e06114 (2015). 66. Barbosa, G. O. & Kornberg, T. B. Protocol for ex vivo time lapse imaging of
37. Wood, B. M. et al. Cytonemes with complex geometries and composition Drosophila melanogaster cytonemes. STAR Protoc. https://doi.org/10.1016/
extend into invaginations of target cells. J. Cell Biol. 220, e202101116 (2021). j.xpro.2022.101138 (2022).
38. Sato, M. & Kornberg, T. B. FGF is an essential mitogen and chemoattractant 67. Wu, Y. et al. Multiview confocal super-resolution microscopy. Nature. https://
for the air sacs of the drosophila tracheal system. Dev. Cell 3, 195?207 (2002). doi.org/10.1038/s41586-021-04110-0 (2021).
39. Guha, A., Lin, L. & Kornberg, T. B. Regulation of Drosophila matrix
metalloprotease Mmp2 is essential for wing imaginal disc:trachea association
and air sac tubulogenesis. Dev. Biol. 335, 317?326 (2009). Acknowledgements
40. Abmayr, S. M. & Pavlath, G. K. Myoblast fusion: lessons from flies and mice. We thank Drs. T.B. Kornberg, G.M. Rubin, K.A. Guss, and S. Roth for sharing reagents;
Development 139, 641?656 (2012). Drs. N. Andrews (U. Maryland), L. Du (U. Maryland), and T. Kornberg (UCSF) for
41. Anant, S., Roy, S. & VijayRaghavan, K. Twist and Notch negatively regulate comments on the manuscript; Drs. T.B. Kornberg and G.O. Barbosa (UCSF) for sharing
adult muscle differentiation in Drosophila. Development 125, 1361?1369 the design of the culture chamber for live imaging. A.P. acknowledges a fellowship from
(1998). UMD CMNS Dean?s Matching Award for T32 GM080201; This work was funded by
42. Wu, Y. et al. Multiview super-resolution microscopy. Nature 600, 279?284 NIH R35GM124878 and R35GM124878-03S1 grants to SR and intramural funding from
(2021). NIBIB-NIH to H.S.
43. Macpherson, L. J. et al. Dynamic labelling of neural connections in multiple
colours by trans-synaptic fluorescence complementation. Nat. Commun. 6, Author contributions
10024 (2015). S.R. supervised the work and designed the project; H.S. supervised Multiview micro-
44. Leikina, E. et al. Myomaker and Myomerger work independently to control scopy; T.M. supervised TEM; A.P. conducted all experiments, and Y.W., X.H., and Y.S.
distinct steps of membrane remodeling during myoblast fusion. Dev. Cell 46, conducted experiments with Multiview microscopy; S.R., A.P., H.S., Y.W., and T.M.
767?780.e7 (2018). contributed to writing the paper.
45. Deng, S., Bothe, I. & Baylies, M. K. The formin diaphanous regulates myoblast
fusion through actin polymerization and Arp2/3 regulation. PLoS Genet. 11,
e1005381 (2015). Competing interests
46. Stathopoulos, A., Tam, B., Ronshaugen, M., Frasch, M. & Levine, M. pyramus The authors declare no competing interests.
and thisbe: FGF genes that pattern the mesoderm of Drosophila embryos.
Genes Dev. 18, 687?699 (2004).
47. Sarov, M. et al. A genome-wide resource for the analysis of protein localisation Additional information
in Drosophila. Elife 5, e12068 (2016). Supplementary information The online version contains supplementary material
48. Everetts, N. J., Worley, M. I., Yasutomi, R., Yosef, N. & Hariharan, I. K. Single- available at https://doi.org/10.1038/s41467-022-28587-z.
cell transcriptomics of the Drosophila wing disc reveals instructive
epithelium-to-myoblast interactions. Elife 10, e61276 (2021). Correspondence and requests for materials should be addressed to Sougata Roy.
49. Losick, V. P., Morris, L. X., Fox, D. T. & Spradling, A. Drosophila stem cell
niches: a decade of discovery suggests a uni ed view of stem cell regulation. Peer review information Nature Communications thanks Steffen Scholpp and the other,fi
Dev. Cell 21, 159 171 (2011). anonymous, reviewer(s) for their contribution to the peer review of this work. Peer?
50. Stepanik, V., Sun, J. & Stathopoulos, A. FGF pyramus has a transmembrane reviewer reports are available.
domain and cell-autonomous function in Polarity. Curr. Biol. https://doi.org/
10.1016/j.cub.2020.06.006 (2020). Reprints and permission information is available at http://www.nature.com/reprints
51. Aradhya, R., Zmojdzian, M., Da Ponte, J. P. & Jagla, K. Muscle niche-driven Publisher?s note Springer Nature remains neutral with regard to jurisdictional claims in
insulin-Notch-Myc cascade reactivates dormant adult muscle precursors in published maps and institutional affiliations.
Drosophila. Elife 4, e08497 (2015).
52. Segal, D., Dhanyasi, N., Schejter, E. D. & Shilo, B.-Z. Adhesion and fusion of
muscle cells are promoted by filopodia. Dev. Cell 38, 291?304 (2016).
53. Gonz?lez-Mendez, L. et al. Polarized sorting of patched enables cytoneme- Open Access This article is licensed under a Creative Commons
mediated Hedgehog reception in the Drosophila wing disc. EMBO J. 124, Attribution 4.0 International License, which permits use, sharing,
e103629 (2020). adaptation, distribution and reproduction in any medium or format, as long as you give
54. Huang, H., Liu, S. & Kornberg, T. B. Glutamate signaling at cytoneme appropriate credit to the original author(s) and the source, provide a link to the Creative
synapses. Science 363, 948?955 (2019). Commons license, and indicate if changes were made. The images or other third party
55. Hatori, R. & Kornberg, T. B. Hedgehog produced by the Drosophila wing material in this article are included in the article?s Creative Commons license, unless
imaginal disc induces distinct responses in three target tissues. Development indicated otherwise in a credit line to the material. If material is not included in the
147, dev195974 (2020). article?s Creative Commons license and your intended use is not permitted by statutory
56. Hatori, R., Wood, B. M., Oliveira Barbosa, G. & Kornberg, T. B. Regulated regulation or exceeds the permitted use, you will need to obtain permission directly from
delivery controls Drosophila Hedgehog, wingless, and decapentaplegic the copyright holder. To view a copy of this license, visit http://creativecommons.org/
signaling. Elife 10, e71744 (2021). licenses/by/4.0/.
57. Mossahebi-Mohammadi, M., Quan, M., Zhang, J.-S. & Li, X. FGF signaling
pathway: a key regulator of stem cell pluripotency. Front. Cell Dev. Biol. 8, 79
(2020). ? The Author(s) 2022
NATURE COMMUNICATIONS |         (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 17